First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Answer:
Environmental, spatial and topographical factors.
Explanation:
Air temperature depends on many diverse environmental (vegetation) and geographical factors, being the most important one the altitude on the sea level since this factor can directly affect the amount of radiation received on the Earth's surface. Recently, many meteorological models capable of estimating air temperature under certain conditions have been developed. These computational models consider a multiplicity of factors and use input data that are associated with the topography and the location (e.g., longitude, latitude and altitude).
Because they cannot consume regular food like us, because they have no throat or digestive system, so they need to make their own food for nutrition.
Answer:
Option B, can be used to either sterilize or pasteurize, depending on the dose of radiation
Explanation:
Sterilization by radiation has started since 1895. However, commercial food irradiation plant was installed at Stuttgart, Germany in 1958. In general gamma radiation is used for sterilization purposes which disrupts the sub-atomic particles involved in the formation of the microorganism at an early stage by damaging their genetic material such as DNA or RNA with in their cells. Once the genetic material i.e DNA or RNA is damaged, the cell dies automatically.
Hence, option B is correct
