1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ugo [173]
3 years ago
10

Which of the following islands was formed from volcanoes? a. Martinique c. Hispaniola b. Cayman Islands d. Cuba

Biology
1 answer:
Morgarella [4.7K]3 years ago
4 0

Answer:

hispaniola oooooooooooooooooooooooooooo

You might be interested in
Which emergency condition requires the immediate use of cardiopulmonary resuscitation (cpr)? quizlety
Black_prince [1.1K]

Emergency condition like Myocardial Infarction requires the immediate use of cardiopulmonary resuscitation (cpr).

<h3>What is Myocardial Infarction?</h3>

Myocardial infarction, another name for a heart attack, is an extremely serious condition caused by inadequate blood flow to your heart muscle. Although there are several potential causes, the most frequent one is a blockage in one or more of the arteries leading to your heart. Without blood supply, the damaged heart muscle will start to degenerate. If blood flow isn't quickly restored after a heart attack, there could be permanent cardiac damage and even death.

A heart attack is an emergency that puts your life in danger. If you think you or someone you're with is having a heart attack, dial 911 immediately (or your local emergency services phone number).

Learn more about Myocardial Infarction with the help of the given link:

brainly.com/question/28187123

#SPJ4

7 0
2 years ago
A mountain range is located in the path of prevailing winds. why does the leeward side of the range have a dry climate?
lesya692 [45]
It would be A. higher.. = wet
4 0
3 years ago
Many factors affect the general climate of a location. Latitude is an important factor in determining the type of climate. Miami
Damm [24]
Locations at latitude closer to the equator receive stronger and more direct sunlight than locations near the poles.
5 0
2 years ago
Read 2 more answers
Plantas de herbolaria mexicana que usamos para calmar problemas digestivos??
Igoryamba
Manzanilla, hinojo, menta puperita, melisa, regaliz, jengibre
8 0
3 years ago
Which variables make a volcano such as Popocatépetl more “dangerous” than others?
Kaylis [27]

Answer:

I think it's B not sure though check in Google or read the book

6 0
3 years ago
Read 2 more answers
Other questions:
  • Plants in a tropical rainforest usually have
    8·2 answers
  • what rock was formed from tiny grains of calcite precipitated from sea or lake waters and has been altered by high pressure?
    6·2 answers
  • Na podstawie życiorysu św Stanisława Kostki uzupełnij tabelę
    6·1 answer
  • What cell part contains an organism’s genome? gene ribosome nucleolus nucleus
    13·2 answers
  • A lynx is a cat with a thick coat that lives in cold climates. Its paws are wide and large, which makes them useful for walking
    10·1 answer
  • Stomache acids killing pathogens is the blank and blank systems working together.
    9·1 answer
  • You made a "cell" using dialysis tubing and a concentrated sugar solution tinted red. You then placed the cell in distilled wate
    15·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which of the following best describes the water found in deep currents of the Atlantic Ocean
    14·1 answer
  • 14. Humans have___
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!