1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
4vir4ik [10]
3 years ago
12

How many ATP's are required to start glycolysis anf how many ATP's are produced?

Biology
1 answer:
Digiron [165]3 years ago
7 0

4 overall ATP's

2 are used

Leaving 2 for a net production of ATP's

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to
posledela

Answer:

The correct answer will be option-E

Explanation:

Hershey and Chase's experiment was performed to test whether DNA serves as the genetic material or protein.

To perform experiment they grew bacteriophage into radiolabeled phosphorus and sulfur compounds. The phosphorus is an integral part of the structure of DNA whereas proteins contain sulfur in their structure.  

In the given condition if radiolabeled nitrogen is utilized then the experiment will fail as the structure of proteins also contains an amino group( NH₂) in their structure as well as DNA. The scientist will not be able to identify whether the DNA is the genetic material or protein.

Thus, option-E is the correct answer.

7 0
3 years ago
Living organisms must constantly take in energy in order to power functions necessary to remain alive. the chemical reaction tha
Alexxx [7]
Respiration ~~~~~~~~
7 0
3 years ago
The sternocleidomastoid muscles help to flex the neck. What are their antagonists
White raven [17]

Answer:

Trapezius.

Explanation:

Sternocleidomastoid muscles may be defined as one of the largest superficial cervical muscle. The main function of this muscle is the neck flexion and the head rotation.  

Trapezius muscle is the large muscle that extend from the occipital bone. The main function of the trapezius muscle is the scapula movement and support of the arm. Trapezium muscle resist the neck flexion and works as the antagonist to the trapezius muscle.

Thus, the answer is trapezius.

5 0
3 years ago
A physician has a patient with diabetes. Due to a mutation in the patient’s insulin gene, he does not make the insulin protein.
Marta_Voda [28]

Answer:

I think its circular DNA or plasmid.

6 0
2 years ago
Other questions:
  • Which is usually the best way to present or communicate inferred data
    12·1 answer
  • This is the last question on my test and i dont know it? please answer quick!
    6·1 answer
  • 3. What is different about the blood carried by the arteries going to the body and the blood carried by the arteries going to th
    8·1 answer
  • Which statement correctly describes the diagram
    10·2 answers
  • You are solar powered.(in a round about way)
    8·1 answer
  • Match the scenario with the theory of motivation that is being described. Some will be used more than once.
    15·2 answers
  • N
    9·1 answer
  • Alleles are described as ____________________. homologous chromosomes homologous chromosomes alternate versions of a gene altern
    14·1 answer
  • I NEED IT ASAP 7th grade<br>What human activities are possibly to blame for coral bleaching? B​
    15·2 answers
  • Which of the following describes how oxygen moves during respiration?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!