1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
boyakko [2]
3 years ago
10

A key characteristic of aquatic dead zones is ________. A key characteristic of aquatic dead zones is ________. a high concentra

tion of urban development a low concentration of oxygen low concentrations of nitrogen and phosphorus a lack of water a low concentration of keystone species
Biology
1 answer:
Snowcat [4.5K]3 years ago
6 0

Answer:

The correct answer is "low concentration of oxygen".

Explanation:

One of the key characteristic of aquatic dead zones is its low concentration of oxygen. Aquatic dead zones are classified into this category for being hypoxic, condition that do not support the growth of most marine life. Most aquatic dead zones are in these conditions because of a high content of nutrient pollution caused by human activities.

You might be interested in
Genetic engineering has many applications, including uses in the medical, agricultural, and environmental industries. Describe o
ivanzaharov [21]

Answer:

Genetic engineering has multiple applications in different fields. Genetic engineering is the process by which alterations are made at the genetic level so that the final product is superior in quality and yield.

Explanation:

Following are few of it's applications:

<u>Medical field</u>- Genetic engineering is been used to produce insulin artificially, human growth hormones, anti hemophiliac factors, vaccines and other drugs.

<u>Agricultural industry</u>- It has been used to synthesize  improvised crops which give better yield and are pest resistant. E.g Flavr savr, a species of tomato which is more juicy and larger in size than regular tomatoes.

<u>Environment</u>- With the introduction of herbicide resistant corn, farmers reduced the use of tractors which in turn reduced the amount of greenhouse gases. Also, by imparting disease resistance to plants, a lot of plants are prevented from dying. In addition, the biodiversity of an area can be maintained.

5 0
3 years ago
Define earthquake (dont goo gle)
Vesna [10]

Answer:an earthquake

Explanation:an earthquake is a violent shaking of the ground and it also creates greate destruction

3 0
3 years ago
What causes the the aliens to change their shape?
satela [25.4K]
It would be temp if my teacher explained it right. hope this helps
6 0
3 years ago
Which of these will help you keep the information from your notes fresh in your mind?
olganol [36]
Hello

Reviewing over by memorizing them
Flash cards
Quizlet
Kahoot!

These are different way to study

Hope this helps
Plz mark me as brainist
8 0
3 years ago
Determine tRNA anticodons<br> UACCUGUUAAGCUACAAAAUU
Pavel [41]

Answer:

i dont know sorry , Gooqle it

7 0
3 years ago
Other questions:
  • Describe a function of a carbohydrate
    14·1 answer
  • What is the example of sexual reproduction a budding the cloning see conjugation and the binary fission
    15·1 answer
  • Part A: Explain why and how the polar covalent bonds found in water molecules are responsible for water's ability to dissolve ma
    10·1 answer
  • A local industrial plant uses oil to run it's furnace and then utilizes the waste heat to convert water to steam to power a turb
    14·1 answer
  • PH
    13·1 answer
  • Which type of energy do you think is better: SOLAR ENERGY or WIND ENERGY?why do you think that ?
    13·2 answers
  • 1. What is the relationship among chromosomes, genes, and DNA?
    5·2 answers
  • Which of the following are examples of a new substance being formed . check all that apply A )bubbles
    13·1 answer
  • Which of the following is equivalent to 36 + 8
    9·1 answer
  • Explain this statement
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!