1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
grigory [225]
3 years ago
15

What do you do when you want to fight someone but don't want to take the consiquence

Biology
1 answer:
Pavlova-9 [17]3 years ago
5 0

Answer:

not fight

Explanation:

you should try to restrain from fighting there will always be a consiquence. whether you know it or not. The Bible clearly states in Romans 12:17 that you should not repay evil for evil (Repay no one evil for evil, but give thought to do what is honorable in the sight of all.).  If the person has sinned against you, forgive them. if you just want to fight for some unknown reason, pray for help from God.

<em>hope this helps :)</em>

You might be interested in
Which one are more important Carbohydrates or Protein?
alex41 [277]

Answer:

Carbohydrate

Explanation:

6 0
3 years ago
Rick, an athlete, notices a ring shaped inflammation around his neck. Which medication can treat this problem?
Dmitriy789 [7]

Answer:

Ring shaped inflammation would make me think ringworm. In which the answer would be Antifungal as you can buy OTC antifungal cream for relief.

Explanation:

6 0
3 years ago
The following image shows a cell before and during the process of mitosis. Before it undergoes mitosis, the cell contains 2n chr
svlad2 [7]

The correct answer is B: The cells will have 2n chromosomes and be diploid.

Diploid cell have two of each chromosome, one from each parent. When diploid cell undergoes mitosis, the result is two identical diploid cells (when haploid cell undergoes mitosis the result is haploid cell). This means that during the mitosis, cells reproduce genetically identical copies of themselves.


6 0
3 years ago
Read 2 more answers
What property of the DNA molecule explains the necessity for Okazaki fragments? DNA is antiparallel. DNA is a linear molecule. D
Arada [10]

Answer:DNA is antiparallel.

Explanation: DNA is a double stranded helix in which the two strands are antiparallel. Being antiparallel means that as one strand runs from 5'->3' direction, the other strand runs from 3'->5' direction. During DNA each of the two strands serves as a template for a new complementary strand. The synthesis of a new DNA strand is always in the 5'->3' direction, therefore one strand is synthesized continuously in the direction of the replication fork while the other strand is synthesized discontinuously in the direction opposite to the replication fork in short fragments called the Okazaki fragments. The strand that is synthesized continuously is called the leading strand while the strand that is synthesized discontinuously in Okazaki fragments is called the lagging strand.

3 0
3 years ago
An object that feels cold has particles that are moving VERY fast. <br><br> A.True<br> B.False
SVEN [57.7K]
B)false an object that feels cold has particles that are moving slowly
3 0
3 years ago
Read 2 more answers
Other questions:
  • A motor neuron transmits the effect of a nerve impulse to the muscle fiber at a _________________.
    15·1 answer
  • _____ arise from a single fertilized egg and are thus genetically almost identical.
    12·2 answers
  • Which sentence describes one difference between DNA and RNA?
    9·1 answer
  • Which structure(s) are connected to the peripheral nervous system?
    13·1 answer
  • What climate related factor helped to form the American Great Plains? What biome is it?​
    8·2 answers
  • Which factor causes the shape of a fatty acid to be straight?
    10·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Which one of these factors does not impact air pressure?
    15·2 answers
  • Which of the following is NOT considered a triadic color scheme?
    5·1 answer
  • Occurs when the individual inherits only one (female) X chromosome
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!