1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SashulF [63]
3 years ago
12

The horticulturalist plans to cross a geranium that is true-breeding for red flowers with a geranium that is true breeding for w

hite flowers. Which Punnett square best describes this cross

Biology
1 answer:
Arte-miy333 [17]3 years ago
8 0

Answer:

Since both plants are true breeding, it means that both are homozygous for the allele of the trait, that is flower color. The geranium plant with red flowers can be denoted as RR and the plant with white flowers can be denoted by WW. Since it is not mentioned in the question that which trait is dominant over  the other, but one thing is sure that all the offspring will look alike in color, because their genotype will be same, RW.

The punnet square that best describes them is in attached figure, please see.

Hope it helps!

You might be interested in
In which structure do sperm cells develop?
horrorfan [7]

Answer:

C

Explanation:

You could literally search that up. It's correct though.

"Sperm develop in the testicles within a system of tiny tubes called the seminiferous tubules. At birth, these tubules contain simple round cells. During puberty, testosterone and other hormones cause these cells to transform into sperm cells."

6 0
3 years ago
Read 2 more answers
Arrange the steps in order to explain how a tornado form
iogann1982 [59]

<span>Step1; Like all strong winds and storms, tornadoes begin when the sun heats the surface of the land. As the warm, less heavy air begins to rise, it meets the colder, heavier air above it creating a strong circular wind. A wind shear is when two winds at different levels and speeds above the ground blow together in a location. </span>

<span><span>Step 2: </span>The faster moving air begins to spin and roll over the slower wind. As it rolls on, it gathers pace and grow in size.</span>

<span>
Step 3: At this stage, it is an invisible, horizontal wind spinning and rolling like a cylinder. As the winds continue to build up, stronger and more powerful warm air forces the spinning winds vertically upward, causing an updraft.

<span>Step 4: </span>With more warm air rising, the spinning air encounters more updraft. The winds spin faster, vertically upwards, and gains more momentum.</span>

<span>Step 5: At this stage, the spinning winds, creates a vortex and the wind has enough energy to fuel itself.

Step 6: The tornado is fully formed now and moving in the direction of the thunderstorm winds. When the pointed part of the tornado touched the ground from the cloud, it is often referred to as </span>'touch down'<span> 
</span>

6 0
3 years ago
Read 2 more answers
Which of the following are responsible for surface currents?
Len [333]

the answer is wind and the earths rotation

I got it right

6 0
3 years ago
Read 2 more answers
When does independent assortment occur
Goryan [66]
Independent Assortment <span>occurs in metaphase I.

</span>
6 0
3 years ago
Read 2 more answers
A 15 year-old underwent placement of a cochlear implant 1 year ago. it now needs to be reprogrammed. what cpt® code is reported
kiruha [24]

The cpt® code reported for the reprogramming is 92604, which is Subsequent reprogramming. Current Procedural Terminology (cpt) is a medical code set that is used to report medical, surgical, and diagnostic procedures and services to entities such as physicians, health insurance companies and accreditation organizations.

6 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Why would a fish that lives in the bathypelagic zone lack a swim bladder and what adaptations would help in maintain neutral bou
    8·1 answer
  • Which nutrient do organisms tend to get from their local ecosystem?
    8·2 answers
  • Under a microscope, you can see that a plant cell has only half the usual number of chromosomes. What stage of the plant’s life-
    9·1 answer
  • 14. Which of the following statements about earthquakes is false? A. The building and release of stress along a plate boundary c
    14·2 answers
  • Individual columns of magma that rise up an come through the lithosphere and form islands
    12·1 answer
  • How does crossing over during meiosis lead to genetic variation?
    11·1 answer
  • What are peptide bonds in protein how manny are there?<br> (includes diagram)
    11·1 answer
  • Chymotrypsin, trypsin, and elastase are digestive enzymes called serine proteases. The serine proteases differ in substrate spec
    12·1 answer
  • A mutation that occurs in the gametes of an organism will most likely be transferred to which of the following.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!