A bacterial strain divides once every 30 minutes. After 90 minutes, a single bacterium can form a total of ___ bacteria

Biology

1 answer:

Nadya [2.5K]3 years ago

8 0

There are a total of (8) bacterium at 90 minutes.

2 at 30 minutes, 4 at 60 minutes, and 8 at 90 minutes.

You might be interested in

Which organelle is responsible for packaging and sending out proteins to their proper destinations?

defon

Answer:

golfing body is responsible for packaging and sending out proteins

3 0

3 years ago

___________ is the attraction of water molecules to one another, while _________ is the attraction of water molecules to other p

taurus [48]

Answer B is the right answer...

5 0

4 years ago

Read 2 more answers

Cartilage has a flexible matrix that can accommodate mitosis of chondrocytes. True or False

Sedbober [7]

Answer:

Cartilage has a flexible matrix that can accommodate mitosis of chondrocytes. True

Explanation:

Cartilage is a tissue, and there can be three different types: fibrous, hyaline and elastic. The cells in each one are in different positions and all theses types can be found in different parts of the body. The cartilage's matrix is made up of glycosaminoglycans, proteoglycans, collagen fibers and, sometimes, elastin. The chondrocytes are specialized cells that produce collagenous extracellular matrix, abundant ground substance that is rich in proteoglycan and elastin fibers.

5 0

4 years ago

What small portion of DNA is responsible for determining an organism's physical traits?

Law Incorporation [45]

Gene :))))))))))))))))))))))

6 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago