1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
umka2103 [35]
3 years ago
9

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

n this part of the tutorial, you will use BLAST to identify and analyze the sequence you assembled in Part B: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT Go to the BLAST website by clicking the Launch BLAST button. Then follow the instructions below. BLAST Search Instructions 1. In the middle of the page, under the Basic BLAST heading, click nucleotide blast. A new page will appear. 2. Copy the nucleotide sequence shown above, and paste it into the Enter Query Sequence box at the top of the new page. 3. In the Choose Search Set box, select the Others (nr etc.) database. In the pull-down menu directly below it, select Nucleotide collection (nr/nt). 4. In the Program Selection box, select Highly similar sequences (megablast). 5. Click the BLAST button near the lower-left corner of the page. Wait for BLAST to complete the search, which may take 10-30 seconds. A new page displays your search results. The Descriptions section of the page lists similar sequences, or hits, with the best statistical match to your query sequence at the top of the list. You should see sequences from several species. If not, see Hint 1 to determine what went wrong. Based on the BLAST results, what can you conclude about your query sequence?

Biology
1 answer:
storchak [24]3 years ago
3 0

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

You might be interested in
The movement of organic molecules, electrolytes, minerals, and water across the digestive epithelium into interstitial fluid is
Ne4ueva [31]
Absorption would be the appropriate term to describe the movement of organic substrates, inorganic ions, vitamins, and water flowing from the epithelium to the interstitial fluid of the digestive tract. The action is a significant digestive process because the absorbed substance would be distributed to the cells via the bloodstream.
5 0
3 years ago
Use the balanced equation of a nitrogen cycle pathway below to support the conservation of matter and energy.
Nastasia [14]

Law of thermodynamics states that matter and energy cannot be destroyed or created, but can be converted from one form to another. A balanced equation ensures that this basic principle is observed.

On the left-hand side of the equation (the reactants), there are 2 Nitrogen moles and 8 Hydrogen moles. After the reaction, the molecules are rearranged. Nonetheless, the moles of Nitrogen and Hydrogen in the products remain the same.


7 0
3 years ago
What best describes the association between the carbon cycle, plants, and animals.
Morgarella [4.7K]
Plants give off oxygen (that we breathe)and breathe in our carbon dioxide that we exhale
3 0
2 years ago
Increasing the volume of air that reaches the alveoli and takes part in gas exchange will cause blood pH to:
Karolina [17]

Answer:

B. increase, because the partial pressure of CO2 in the blood will decrease.

Explanation:

The presence of carbon dioxide gas in blood imparts H+ ions due to its reaction with H2O and thereby, lowers down the blood pH.

When more air reaches alveoli, the rate of gaseous exchange is increased. More of the carbon dioxide is removed from the blood and is released out of the body via exhalation.

Removal of carbon dioxide from blood would increase the pH of the blood since the partial pressure of CO2 in the blood would decrease.

8 0
2 years ago
How did the frequency of stimulation affect the amount of force generated by the isolated skeletal muscle when the frequency of
Alexxandr [17]

Answer:

When the frequency of stimulation of a muscle increases -without it having the opportunity to relax- a process called summation (addition) occurs, promoting an increase in the generation of force in the isolated skeletal muscle.

Explanation:

Summation is a phenomenon that occurs as a consequence of the arrival of successive stimuli that produce the contraction of the skeletal muscle before it achieves its partial or total relaxation, between subsequent stimuli.

<em>When the summation occurs in the muscle, the force generated on it increases its magnitude proportionally to the number of stimuli received, maintaining the muscle contraction in time</em>.

Tetany is the prolonged contraction of a muscle in an abnormal way, by the summation of stimuli received , as some bacterial toxins can produce. The summation can be temporary -when multiple stimuli reach the muscle in a determined time- or spatial, when the amount of stimuli activates a greater amount of motor units.

Learn more:

Spatial summation in a post synaptic neuron brainly.com/question/9632682

3 0
3 years ago
Other questions:
  • Germ theory that states that microorganisms, which are too small to be seen without the aid of a microscope, can invade the body
    6·2 answers
  • As ____________ increases, the two-point threshold decreases. receptor number receptor density receptor sensitivity receptor sen
    8·1 answer
  • What are some things that are not composed of cells
    14·1 answer
  • The _______ system breaks down food, and the _______ system transports nutrients to the cells of the body. A. circulatory; diges
    13·1 answer
  • Imagine disease kills 85 percent of the wolf population. How will it affect the other organisms?
    10·2 answers
  • The big bang theory has finally answered one of the biggest questions of science—the origin of the universe is it true or false?
    15·2 answers
  • Will mark BRAINLIEST to correct answer
    15·2 answers
  • If a rock has bands of light and dark layers it is
    12·1 answer
  • Help!!!!!!!!!!!!!!!!!!!
    6·2 answers
  • Which of the following is a biotic factor in an ecosystem?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!