BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
n this part of the tutorial, you will use BLAST to identify and analyze the sequence you assembled in Part B: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT Go to the BLAST website by clicking the Launch BLAST button. Then follow the instructions below. BLAST Search Instructions 1. In the middle of the page, under the Basic BLAST heading, click nucleotide blast. A new page will appear. 2. Copy the nucleotide sequence shown above, and paste it into the Enter Query Sequence box at the top of the new page. 3. In the Choose Search Set box, select the Others (nr etc.) database. In the pull-down menu directly below it, select Nucleotide collection (nr/nt). 4. In the Program Selection box, select Highly similar sequences (megablast). 5. Click the BLAST button near the lower-left corner of the page. Wait for BLAST to complete the search, which may take 10-30 seconds. A new page displays your search results. The Descriptions section of the page lists similar sequences, or hits, with the best statistical match to your query sequence at the top of the list. You should see sequences from several species. If not, see Hint 1 to determine what went wrong. Based on the BLAST results, what can you conclude about your query sequence?
1 answer:
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
You might be interested in
Explanation:
Since Charles found that the volume is directly proportional to temperature when the mass and pressure remain constant this means that with increase in temperature, there will be increase in volume.
Mathematically, at constant Pressure
This equation represents the relationship in Charles' law.