1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
umka2103 [35]
3 years ago
9

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

n this part of the tutorial, you will use BLAST to identify and analyze the sequence you assembled in Part B: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT Go to the BLAST website by clicking the Launch BLAST button. Then follow the instructions below. BLAST Search Instructions 1. In the middle of the page, under the Basic BLAST heading, click nucleotide blast. A new page will appear. 2. Copy the nucleotide sequence shown above, and paste it into the Enter Query Sequence box at the top of the new page. 3. In the Choose Search Set box, select the Others (nr etc.) database. In the pull-down menu directly below it, select Nucleotide collection (nr/nt). 4. In the Program Selection box, select Highly similar sequences (megablast). 5. Click the BLAST button near the lower-left corner of the page. Wait for BLAST to complete the search, which may take 10-30 seconds. A new page displays your search results. The Descriptions section of the page lists similar sequences, or hits, with the best statistical match to your query sequence at the top of the list. You should see sequences from several species. If not, see Hint 1 to determine what went wrong. Based on the BLAST results, what can you conclude about your query sequence?

Biology
1 answer:
storchak [24]3 years ago
3 0

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

You might be interested in
The probability of having the combination of one head and one tail when flipped two coins is
meriva
25% i AM PRETTY SURE
8 0
4 years ago
What's the difference between a lytic cycle and a lysogenic cycle.
Anna007 [38]
 here is where i found the answer https://www.enotes.com/homework-help/what-differences-between-lytic-cycle-lysogenetic-296019 
7 0
4 years ago
Read 2 more answers
16. Refer to the illustration above. Which of the following correctly indicates the order in which these events occur?
Stolb23 [73]

Answer:

b. "C" “B” “A,” “D”

Explanation:

C is prophase because the nuclear envelope starts to disappear and the centrosomes divide

B is metaphase because chromosomes line up to form the equatorial plate

A is anaphase because the sister chromatids are separated

D is telophase because new nuclei form around the separated genetic material

3 0
3 years ago
The slogan "reduce, reuse, recycle was used to educate the community on
vodomira [7]
An increase in sustainable practices
7 0
3 years ago
Which best describes the results of this experiment
mart [117]

Answer: which experiment??

Explanation:

4 0
4 years ago
Other questions:
  • How does the theory of evolution explain the similarities and differences among living organisms?
    14·1 answer
  •  A/An _______ is characteristic of children at age five. 
    9·2 answers
  • how do I find the mothers genotype if I know the genotype of the fater and only the two sons instead of three
    5·1 answer
  • Lymphedema is caused by a blockage in the lymphatic system that causes lymph buildup. Which strategies are the best ways to cont
    13·1 answer
  • Which carbohydrate(s) provide short-term energy storage.
    14·1 answer
  • Identify the process of comparing what you already know with new information
    6·1 answer
  • Consider the sex-linked inheritance patterns of a cross between two flies, a white-eyed female (XWX) and a red-
    11·2 answers
  • Water has a density of 1g/mL. There are four rocks that all have the same volume of 10 cubic centimeters. The mass for each of t
    14·2 answers
  • Why is it necessary to prepare karyotypes by viewing somatic.
    7·1 answer
  • 50 POINTS!!!! The following diagram shows the branching tree for four kingdoms and some of their shared derived characteristics.
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!