1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
umka2103 [35]
3 years ago
9

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

n this part of the tutorial, you will use BLAST to identify and analyze the sequence you assembled in Part B: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT Go to the BLAST website by clicking the Launch BLAST button. Then follow the instructions below. BLAST Search Instructions 1. In the middle of the page, under the Basic BLAST heading, click nucleotide blast. A new page will appear. 2. Copy the nucleotide sequence shown above, and paste it into the Enter Query Sequence box at the top of the new page. 3. In the Choose Search Set box, select the Others (nr etc.) database. In the pull-down menu directly below it, select Nucleotide collection (nr/nt). 4. In the Program Selection box, select Highly similar sequences (megablast). 5. Click the BLAST button near the lower-left corner of the page. Wait for BLAST to complete the search, which may take 10-30 seconds. A new page displays your search results. The Descriptions section of the page lists similar sequences, or hits, with the best statistical match to your query sequence at the top of the list. You should see sequences from several species. If not, see Hint 1 to determine what went wrong. Based on the BLAST results, what can you conclude about your query sequence?

Biology
1 answer:
storchak [24]3 years ago
3 0

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

You might be interested in
NEEED HELP ASAP!!!
Nana76 [90]
Answer is B or the ball because other options don’t have any velocity and it makes the kinetic energy zero for them .the formula is k=1/2mv^2
8 0
3 years ago
Ileocecal sphincter tone decreases (relaxes) after distention of which structure?
stepan [7]
Ileocecal sphincter tone decreases after distention of colon. This sphincter separates ileum and cecum and is under the control of vagus nerve. 
6 0
4 years ago
What is bacteria of decay?
IrinaVladis [17]
1. The separation of a substance into simpler substances or basic elements. 2. The process of decaying or rotting. Decomposition of dead organic matter is brought about by the activity of certain bacteria and fungi feeding on it.
6 0
4 years ago
PLS HELP I WILL GIVE YOU BRAINLIEST AND PLS EXPLAIN YOUR ANSWER!!!
Kipish [7]

Answer:

Most likely centripetal force. Newton's first law states that an object in motion will continue to remain in motion unless acted upon by an outside force. In this case, that outside force is the centripetal force.

Explanation:

Hope this helps :)

8 0
3 years ago
The per capita ecological footprint is the total ecological footprint for a given country or area
Phantasy [73]

The per capita ecological footprint is the total ecological footprint for a given country or area is false and is therefore denoted as option B.

<h3>What is Ecological footprint?</h3>

This is referred to as the amount of land which is required to ensure that there is adequate use and sustainability of the resources which are present in area at a given period of time.

The per capita ecological footprint is the average ecological footprint for a given country or area and not the total ecological footprint which is therefore the reason why false was chosen as the most appropriate choice.

Read more about Ecological footprint here brainly.com/question/14441911

#SPJ1

3 0
1 year ago
Other questions:
  • What sequence on a dna molecule indicates where rna polymerase should begin transcription?
    9·1 answer
  • Oily or fatty ingredients that prevent moisture from leaving the skin are:
    13·1 answer
  • Match each term with the appropriate definition.
    8·1 answer
  • Coral reefs are unaffected by pollution.<br> true or false
    13·1 answer
  • The Coriolis effect contributes to ________.
    13·1 answer
  • What are the difference and similarities between saprotrophs and parasities​
    12·1 answer
  • Sam drives an excavator at an open surface strip coal mine. Which type of coal is he most likely to collect closest to the surfa
    9·1 answer
  • Which animal is most closely<br> related to primates?
    8·2 answers
  • The law of conservation of energy states that energy cannon be created or destroyed.
    5·2 answers
  • Please help
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!