1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
umka2103 [35]
3 years ago
9

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

n this part of the tutorial, you will use BLAST to identify and analyze the sequence you assembled in Part B: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT Go to the BLAST website by clicking the Launch BLAST button. Then follow the instructions below. BLAST Search Instructions 1. In the middle of the page, under the Basic BLAST heading, click nucleotide blast. A new page will appear. 2. Copy the nucleotide sequence shown above, and paste it into the Enter Query Sequence box at the top of the new page. 3. In the Choose Search Set box, select the Others (nr etc.) database. In the pull-down menu directly below it, select Nucleotide collection (nr/nt). 4. In the Program Selection box, select Highly similar sequences (megablast). 5. Click the BLAST button near the lower-left corner of the page. Wait for BLAST to complete the search, which may take 10-30 seconds. A new page displays your search results. The Descriptions section of the page lists similar sequences, or hits, with the best statistical match to your query sequence at the top of the list. You should see sequences from several species. If not, see Hint 1 to determine what went wrong. Based on the BLAST results, what can you conclude about your query sequence?

Biology
1 answer:
storchak [24]3 years ago
3 0

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

You might be interested in
When a protein (peptide) hormone binds to receptors on the surface of a cell:
Licemer1 [7]

Answer:

the cell membrane becomes depolarized.

Explanation:

Na+ moves in, K+ moves out.

hope it helps!

7 0
3 years ago
Read 2 more answers
Which increase the rate of soil formation? Check all that apply.
Rainbow [258]

Answer:

large grain sizes, more precipitation, warmer temperatures.

Explanation:

Soil is the thin layer of material covering the earth's surface and they are usually formed through the process of weathering of rocks. The soil consists of mainly mineral particles, organic materials, air, water and living organisms and they interact with each other.

Large grain sizes, more precipitation, warmer temperatures are the factors that increase the rate of soil formation.

5 0
3 years ago
Read 2 more answers
True or false: surveillance can be performed through either stationary or mobile means.
Ivanshal [37]
<span>This is true. Surveillance can be performed efficiently through both stationary and mobile means. As far as human surveillance goes, people can track other people by tailing them or by using a stationary means such as a stake out. As far as technology goes, there are plenty of mobile devices that can be used for surveillance such as tracking devices. Security cameras can be used for stationary purposes.</span>
6 0
3 years ago
Organism 1
Ahat [919]

The correct scientific name for Organism 1 is <em>Phoebis philea</em>.

<u>Explanation:</u>

The species of butterfly scientifically named as <em>Phoebis philea </em>and commonly named as orange-barred sulfur, basically found in Americas. Its scientific classification involve following points: Kingdom is Animalia; Phylum is Arthropoda; Class is Insecta; Order is Lepidoptera; Family is Pieridae; Genus is Phoebis and Species is P. philea.

The environment of this species is in tropical scrub, parks, fields and edges of the forest. The creature takes nectar from plants of red colour.  The larvae depend on the species Cassia. Wingspan is between 68 and 80 mm. In Florida there are 2-3 generations a year, and one in the northern region of the range with winged adults from mid to late summer.

3 0
2 years ago
Read 2 more answers
Explain how small segments of dna can be sequenced directly and quickly
defon
Using little tweezers  you can pull each strand 
8 0
3 years ago
Other questions:
  • I do not understand because I was not in class. Can you please help me answer these questions.
    14·1 answer
  • Which is a fuction of the protein hemolobin
    13·1 answer
  • What role can sulfur play in the makeup of amino acids and proteins?
    5·2 answers
  • In fruit flies, a specific gene mutation causes the wings to become malformed. These wings are called vestigial because they do
    8·2 answers
  • Construct incomplete dominance vs codominance
    9·1 answer
  • The type of reflection in which the light is scattered into many directions is known as
    14·2 answers
  • 4. Which form of transport through a cell membrane does not require the use of energy:
    6·1 answer
  • You are planning a three day trip to Seattle Washington in October use the fact that on each day it could be either sunny or rai
    6·1 answer
  • What structures do human epithelial cells have in common with elodea cells
    9·2 answers
  • Outline the events of protein synthesis (transcription and translation)
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!