All categories

3 years ago

"All minerals cannot be magnetized." What does this statement most likely represent?

Biology

1 answer:

Marysya12 [62]3 years ago

5 0

Answer:

The ansewer is the minerals can be shifted

Explanation:

You might be interested in

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

A stem growing up and out of the soil, away from gravity is an example of a _______.

Tomtit [17]

<span>A tropism is a movement of an organism toward or away from a stimulus. A positive tropism is when the organism moves toward the stimuli. A negative tropism is when the organism moves away from the stimuli. So, your answer will be negative tropism, since the stem is growing up and out of the soil, AWAY from gravity.</span>

5 0

3 years ago

1. How would an investigator process patent(direct) prints?

Katena32 [7]

Patent fingerprints are made by a liquid or powder that sticks to the finger and then transfers to a surface, leaving an easily visible fingerprint behind. Substances that can leave patent fingerprints are ink, blood, dirt, flour, grease, etc.

4 0

3 years ago

Give reasons.

Bess [88]

Answer:

1.It produces silk which is a high quality fibre

2.to destroy the gelatinious substance inside cocoon so as to obtain silk thread

3.To avoid it from hatching

4.they carry pollen grains while roaming plant to plant and help in cross pollination

8 0

3 years ago

What is involved in creating genetically modified bacteria?

eduard

Answer:

A small piece of circular DNA called a plasmid? is extracted from the bacteria or yeast cell. A small section is then cut out of the circular plasmid by restriction enzymes, 'molecular scissors'. The gene for human insulin is inserted into the gap in the plasmid. This plasmid is now genetically modified.

Explanation:

7 0

2 years ago