1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirza4 [7]
3 years ago
10

Where do electrons get their energy in the light reactions?

Biology
2 answers:
erica [24]3 years ago
7 0

Answer:

energy in light

Explanation:

galben [10]3 years ago
5 0
For the answer to the question, where do electrons get their energy in the light reactions? The answer is multiple choice letter <span>D. From photons in solar energy.

I hope my answer helped you.Feel free to ask more questions. Have a nice day!</span>
You might be interested in
Evolution is all of the following
frosja888 [35]

♛┈⛧┈┈•༶༶•┈┈⛧┈♛♛┈⛧┈┈•༶༶•┈┈⛧┈♛

3 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Color in McIver beetles is determined by two alleles at one gene locus. McIver beetles must have a heterzygous genotype (genotyp
seraphim [82]

Answer: The frequency of brown beetles is 0.32.

Explanation: The frequency of A1 allele is 0.8. As p+q=1, or the sum of dominant and recessive frequencies equals 1 or 100%:

1 - 0.8 = 0.2

In Hardy-Weinberg principle,

p^{2} + 2pq + q^{2} = 1

2pq represents the frequency of heterozygote individuals, so:

genotype A1A2 = 2*0.8*0.2 = 0.32.

Thus, the frequency of brown beetles (A1A2) in the population is 0.32.

3 0
3 years ago
Please answer these questions clearly you will get lot of points like 30!!!
kupik [55]
10) the cv is wrong; it should be the number of coats of nail polish she applies
11) the iv is wrong; it should be the amount of paperclips on each plane (so basically the weight of each plane)
7 0
3 years ago
What is the result of a substitution mutation?
expeople1 [14]

Answer:

The new amino acid may be the same as the original amino acid or it may be different.

3 0
3 years ago
Read 2 more answers
Other questions:
  • If a cell has 24 chromosomes how many will it have at the end of mitosis
    5·1 answer
  • Which is a biotic factor operating within an ecosystem?
    6·1 answer
  • What happens during an equinox
    15·1 answer
  • Troy's weight has always been around 180 pounds. when he gains a few pounds, he usually drops the extra weight relatively quickl
    5·2 answers
  • the chloroplast, a tiny body within plant cells, is the power generator for life on earth true or false
    7·2 answers
  • Which of the following is not a characteristic of all living things?
    13·1 answer
  • Evidence of climate changes and conditions that affected early societies are gathered from _____. written records ice core sampl
    12·1 answer
  • An organism lives in a container with very little oxygen. it produces ethanol and carbon dioxide as waste products. which proces
    11·1 answer
  • Brainliest for right answer
    15·2 answers
  • What is the structure of the forebrain that connects the two hemispheres of cerebrum?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!