I believe it is A
sorry if I'm wrong but I hope it helps!
please make my answer brainliest!!
Thanks!!
Answer:
Explanation:
does it give any other info on the woman or is that it?
Answer:
D. Inhibits the degradation of 2,3-BPG, thereby increasing its concentration in erythrocytes
Explanation:
A pharmaceutical company trying to develop a drug that improves tissue oxygenation by increasing the percentage of oxygen that is released from hemoglobin during its passage through the capillaries of extrapulmonary tissues. This drug, it is hoped, would become a popular doping agent for athletes.This means that the company should try a drug that Inhibits the degradation of 2,3-BPG( 2,3-Bisphosphoglycerate) , thereby increasing its concentration in erythrocytes
I'm afraid none of those is correct. The correct option would be subspecies. Subspecies are different variations, one could say, of a same organism.
Hope it helped,
Happy homework/ study/ exam!
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
