1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
earnstyle [38]
3 years ago
14

Match each type of rock with the description of how it forms.

Biology
2 answers:
rjkz [21]3 years ago
7 0

Answer:

Sedimentary = layers of sediment dry together

Metamorphic = existing rocks are exposed to extreme conditions

igneous =magma or lava solidifies

Explanation:

monitta3 years ago
3 0

Answer:

Metamorphic - existing rocks are exposed to extreme conditions

Sedimentary - layers of sediment dry together

igneous - magma or lava solidifies

You might be interested in
Carbon dioxide is added to the atmosphere:
devlian [24]
B.
When fossil fuels are burned carbon dioxide is released in to the atmosphere
hope this helps
8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Why rapid binge drinking is more dangerous than slower consumption of alcohol?
Tpy6a [65]
The same way we never inject a full bag of anything quickly and intravenously. Your body would not be able to compensate for the amount of the substance. Alcohol or more importantly the Ethanol or Ethyl Alcohol in alcoholic beverages is the active ingredient of such beverages. It is also a drug called a CNS (Central Nervous System) depressant which means it is in the same class category of Opioids (Such as Heroin and Morphine) and Barbiturates (Rophynol). Your body processes alcohol via the liver, as it is also considered a toxin. By consuming a massive amount of alcohol without spacing it out, you will overload your system, not only literally overwhelming your liver and causing Alcohol Poisoning, but you also can go into a state similar to a Heroin overdose. 
7 0
3 years ago
The HR diagram represents stages in the life cycle of a star.
Veseljchak [2.6K]

white dwarf

Explanation:

A appears on the chart at the point of low luminosity but high surface temperatures. This indicated  a White Dwarf

A red giant is highly luminous stars mainly because of its large size. However, its surface temperature is hot a high when compared to white dwarfs. White dwarf surface temperatures can reach billions of degrees kelvin while red giants reach up to 5000 K on their surface.

A white dwarf is the last sequence of a low-mass star cycle and follows the red giant phase.

4 0
3 years ago
Read 2 more answers
How much would a 125 pound person weigh on pluto​
Reika [66]

Answer:

77.5lbs

Explanation:

Weight × Pluto's surface gravity

125 x 0.62 = 77.5

3 0
3 years ago
Read 2 more answers
Other questions:
  • When diet and health are adequate, __________ is largely influenced by heredity. the onset of menarche height weight the onset o
    6·2 answers
  • Why did Gregor Mendel conclude that the genes for flower and seed color in pea plants independently assorted even though both tr
    15·1 answer
  • Which of the following describes describes a response to external stimuli?
    5·1 answer
  • David works at an adhesive manufacturing plant. Which industrial solvent is he likely to use? ozone carbon nitrogen oxide methyl
    8·1 answer
  • The half-life of carbon-14 is 5730 years. Radiocarbon dating can not be used to estimate the age of objects up to about 50,000 o
    6·1 answer
  • What does horizontal line between a circle and a square represent
    7·1 answer
  • True or False<br><br> Osmosis is the movement of water into and out of a cell.
    11·2 answers
  • What is the greatest degree of genetic diversity
    13·1 answer
  • PLEASE HELP , WILL GIVE BRAINLIEST. In Mendel’s first experiment, he crossed tall plants with short plants and found tall plants
    7·1 answer
  • What are the uses of compases?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!