All categories

3 years ago

The Cascade Range is also known as the

Geography

2 answers:

Maksim231197 [3]3 years ago

7 0

Answer:

Cascades

Explanation:

Did research and this is what I found. Hope this helps!

givi [52]3 years ago

6 0

Answer:

the Cascades

Explanation:

because the Cascades range is a major mountain range and honestly I'd assume most people wouldn't call it by the full name so just like with most things they decided to shorten the name

You might be interested in

When magma solidifies underground, the resulting landform is classified as _______.

galina1969 [7]

Answer:

1. When magma solidifies underground, the resulting landform is classified as Intrusive rocks.

2. Lava cooling on the surface of the earth forms Extrusive igneous rocks features.

3. A very large mineral is more likely to be found in Igneous rock.

4. Lava is magma that forms in long, horizontal shafts in the earth’s crust.

5. Lava with high basalt content forms high ferromagnetism through multiple eruptions.

Explanation:

1. Intrusive rock is formed when magma penetrates existing rock, crystallizes and solidifies underground to form intrusions. Intrusive rock forms within Earth's crust from the crystallization of magma.

2. Extrusive igneous rocks form when magma reaches the Earth's surface of a volcano and cools quickly. Most extrusive rocks have small crystals.

3. Igneous rock or magmatic rock, is one of the 3 main rock types. The other 2 are called sedimentary and metamorphic. Igneous rock is formed through the cooling and solidification of magma or lava.

4. Lava is molten rock generated by geothermal energy and expelled through fractures in planetary crust or in an eruption, usually at temperatures from 1.292 to 2.192 °F.

5. Mafic or basaltic lavas are best known by their high ferromagnesian content.

Eruptions associated with basaltic lava usually are not explosive due to the low silica and gas content.

Because of the low viscosity, basaltic lava flows spread out, forming extensive layers. They may build up to form a large shield volcano.

3 0

3 years ago

Read 2 more answers

What feature of pueblo life has divided the pueblo peoples for centuries?

NISA [10]

settlement that has houses made of stone, adobe, and wood

4 0

2 years ago

Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA

Rina8888 [55]

Answer:

Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0

3 years ago

Why is the recycling of matter important?

Sergeu [11.5K]

Natural ecosystems are able to maintain a vibrant diversity of life because they incorporate intricate recycling systems that conserve essential materials.

6 0

3 years ago

Which of the following are traits of a representative democracy

Fed [463]

We cant see the picture sorry

7 0

2 years ago