1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mademuasel [1]
3 years ago
10

How will the filtration rate in the renal corpuscles be affected if a kidney stone creates a blockage of the urinary tract?

Biology
1 answer:
Leviafan [203]3 years ago
7 0

Answer:

There will be a progressive fall in glomerular filtration rate.

Explanation:

The glomerular filtration rate,GFR, shows how well the Kidney is functioning or working. When the Kidney is not working well, it doesn't filter the way it should.

Note that, Glomerular filtration is the process of removing wastes and excess fluid to become part of the urine, by the kidney.

You might be interested in
Please, serious answers only, don't search it up. Can an animal adapt into a new species? If so, why?
Leona [35]

Answer:

Hi how are you doing today Jasmine

7 0
3 years ago
Maria visited the mountains in Wyoming and became interested in the different ways that mountains and valleys form. How do mount
Korvikt [17]

Answer:

A

Explanation:

Mountains are usually formed at what are called convergent plate boundaries, meaning a boundary at which two plates are moving towards one another.

7 0
3 years ago
What is a gene pool?
Delvig [45]
Genetic information, population or species.
6 0
3 years ago
Read 2 more answers
HEEEEEEEEEELLLLLLLLLLLLLLLLLPPPPPPPPPPPPPPPPPP.
dlinn [17]
Asexual reproduction is quicker since it <span>generates offspring that are genetically identical to a single parent.</span>
5 0
3 years ago
Generally speaking, which of the following mutations would most severely affect the protein coded for by a gene?a) a base substi
Pavlova-9 [17]

Answer:

Answer is C.

Explanation:

For A and B, a base substitution affects one of the three bases that comprise a codon, the DNA/RNA unit that corresponds to a particular amino acid. If one base is substituted, one codon and therefore one amino acid will be affected. Codons have built-in redundancy, so even by changing one base, the new codon sometimes still corresponds to the same amino acid. Therefore, a base substitution at most affects one amino acid, and sometimes doesn't affect it all.

Frameshift mutations cause a lot more trouble. These occur when you have a deletion or insertion that changes the number of bases in your gene. As a result, the "frame" of the codons changes (everything shifts one way or the other by the number of bases added/removed). This affects EVERY codon downstream of the mutation, so you can imagine that such a mutation would have a bigger effect the closer to the start of the gene it occurs. This is why C is correct.

3 0
3 years ago
Other questions:
  • What basic unit of heredity is found on segments of DNA and are passed on from parent to offspring? nucleotide gene phosphate mo
    8·2 answers
  • Which product comes from plants?
    11·1 answer
  • When flies having a gray body and normal wings were crossed with flies having a black body and vestigial wings, the F2 generatio
    13·1 answer
  • .) 12. According to cell theory, what do each of the following organisms have in common? A.They can all reproduce by spontaneous
    12·1 answer
  • What are the sections of aquifers?
    9·1 answer
  • Scientific knowledge becomes stronger and more durable as a result of
    8·1 answer
  • What is a maromolucule
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What do prokaryotes have in common with eukaryotes
    8·2 answers
  • Which statement best describes evolution in a population?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!