1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kupik [55]
4 years ago
7

You've discovered a new plant species in which

Biology
1 answer:
valina [46]4 years ago
6 0

Answer:

All the crossing will be like this after realizing it:

Explanation:

Gl x Gl

GG, Gl, Gl, ll

gl x gl

gg, Lg, Lg, LL

On the first crossing we'll have 50% Gl and both other genotypes will be 25%

On the second crossing we'll have 50% Lg and both other genotypes will be 25%.

You might be interested in
What happens during transcription?
Marizza181 [45]
During Transcription Some Letters Are Switched Out.
4 0
4 years ago
Read 2 more answers
Within the chemical bonds of CaCl2, the electrons are what?
Gre4nikov [31]

Answer:

NOT B. OR D. MAY BE C.

Explanation:

hope this helps ya

4 0
3 years ago
What challenges do hydrostatic pressure creates for marine scientists
KengaRu [80]

Answer:

The oceans are present on the 70 percent of the world but only 5 percent of the total oceans are explored yet.

There are many reasons of this problem but the most important is the hydrostatic pressure.

Hydrostatic pressure can be described as the pressure or weight exerted by the water on the object.

With every increase in 10 meters the pressure increase by 6.47kg (14.27lbs) each square inch of surface.

Due to extreme pressure, oxygen level in the cells of body fluctuates and person becomes unstable and can become unconscious.

4 0
3 years ago
What ,is the green pigment that absorbs light in the chloroplasts
Alexeev081 [22]

chloryphyll is the green pigment


5 0
3 years ago
Read 2 more answers
If two organisms possess similar structures that serve similar functions but don't possess a common ancestor that shared that st
AleksandrR [38]

Answer:

D. analogous.

Explanation:

Analogous organs can be defined as organs, which show similar functions, but do not having common origins. Organisms that possess analogous organs do not share common ancestor as their organs are derived from different origins.

Examples of analogous organs include wings of bats, birds, and birds which are evolved independently, but share common function (flying).

Thus, the correct answer is option (D).

5 0
3 years ago
Other questions:
  • Which predictions made by lamarck turned out to be valid?
    8·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • A multilayered neural network​ technique, known as​ ________, has greatly increased the practical usefulness of artificial intel
    7·1 answer
  • The bond formed from electrons that are transferred is a(n)
    10·1 answer
  • In some chickens, the genes for black feathers and white feathers are codominant. What would be the result of mating a chicken w
    12·2 answers
  • The probability of producing a normal child by two parents who are carriers for an autosomal recessive disorder is ____.
    5·1 answer
  • All the chemical reactions within a cell or organism are known as
    6·1 answer
  • Describe the procedure for self-examination of the breasts.
    15·1 answer
  • Diffusion of water across a membrane from areas of higher concentration to areas of lower concentration is called
    5·1 answer
  • Loss of what component in the extracellular matrix would result in lack of adhesion?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!