1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stira [4]
4 years ago
5

8. Explain how DNA serves as its own template during DNA replication?

Biology
1 answer:
Temka [501]4 years ago
8 0

Answer and explanation:

DNA replication happens thanks to one of the strands serving as a template to guide the process. This way, a new strand is synthesized from the original strand. The synthesis of the new strand is antiparallel to the original strand, therefore maintaining one of the key elements of the structure of the DNA molecule. This specific property of DNA replication is what makes this process semiconservative.

You might be interested in
I will mark u as brainliest correct answer only
exis [7]

Tiger frogs have similarities in their mitochondrial DNA that are not shared by other frog species

8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
The health care provider is teaching the parents of children with genetic defects basic genetics. Which information about human
OverLord2011 [107]
Nitrogenous bases, double stranded, made of nucleotides, adenine, thymine, cytosine, guanine, A pairs with T, G pairs with C
4 0
3 years ago
31. The data in the accompanying graph show evidence of disease in the human body. D 38 - - E Body Temperature (°C) 377 А IDOT B
shepuryov [24]

Homeostasis keeps the organism in a dynamic equilibrium within the homeostatic range. <em>A </em><em>disruption i</em><em>n </em><em>dynamic equilibrium </em><em>is indicated by the </em><em>temperature </em><em>change between point C and D.</em> Option C is correct.

<h3>What is homeostasis?</h3>

Homeostasis is the organism's capacity to keep the body in constant internal equilibrium, even when the external environment is oscillating.

Homeostasis is critical to keep the correct internal functioning of the body.

Different functions -blood pressure, body temperature, respiratory rate, and blood glucose levels, among others- are kept in a<u><em> </em></u><u><em>restricted range</em></u><u><em> </em></u>around a reference point, even though external conditions may be changing.

When a sudden change occurs in the internal functioning that disturbs this equilibrium, the organism counters it back by negative or positive feedback.

<h3>Graph interpretation</h3>

In the exposed graph we can see,

  • The restricted range of homeostasis at a constant temperature around 37ºC.

  • Six reference points (A-F) withing 12 hours.

  • Dynamic equilibrium is kept in the range of homeostasis around 37ºC, excepting for point D that reaches 38ºC.  

The references point A, B, and C suggest that during the first 10 hours, approximately, the body was in equilibrium.

A change in the internal functioning broke the equilibrium, rising temperature to 38ºC, out of the homeostatic range.

The organism took the internal values to their original state, and at points E and F, the organism was in equilibrium again.

<em />

<em>A </em><em>disruption i</em><em>n </em><em>dynamic equilibrium </em><em>is indicated by the </em><em>temperature </em><em>change between point C and D. </em>

<em />

<em />

<em>You can learn more about </em><em>homeostasis </em><em>at</em>

<em>brainly.com/question/9087319</em>

<em>brainly.com/question/860558</em>

<em>brainly.com/question/21324446</em>

7 0
3 years ago
A pea plant with the recessive phenotype for plant height would have which of
lilavasa [31]

Answer:

tt

Explanation:

T=dominant

t=recessive

To be considered recessive, 2 lowercase letters are required.

TT or Tt have at least one dominant allele

8 0
3 years ago
Other questions:
  • Why is it important to eat a full healthy meal before an afternoon of playing sports
    8·2 answers
  • Why does the number of phagocytes and lymphocytes in the body increase during an infection?
    12·1 answer
  • A cell membrane is ...................which means that it allows only
    13·1 answer
  • Waves are caused by wind. How would waves most likely affect the abundance of aquatic organisms living near the shore?
    13·2 answers
  • What is instantaneous speciation?
    6·2 answers
  • What is the storage and quick-energy forms of carbohydrates found in animals?
    6·2 answers
  • 2. For a particular rodent, black fur (B) is dominant over brown fur (b), and a long tail
    14·1 answer
  • Explain how T.V. and movie animal "stars" learn to do the extraordinary tricks asked of them.
    13·2 answers
  • Digestion of nutrients begins in varying places. For carbohydrates it begins in the ________, for proteins in the _____ and for
    10·1 answer
  • Identify the letter that indicates a flexible tube that has c-shaped cartilaginous rings that keep it from collapsing.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!