1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Licemer1 [7]
2 years ago
5

After changing a dressing that was used to cover a draining wound on a client with vancomycin-resistant enterococci (vre), the n

urse should take which step to ensure proper disposal of the soiled dressing?
Biology
1 answer:
Mamont248 [21]2 years ago
3 0
<span>the nurse should dispose the dressing in a red bag labeled as hazardous material. Remember that any material coming from an infected patient is considered as infectious. it is potentially infectious to the human body, especially to those who are immunocompromised. Vancomycin resistant enterococci is a bacteria which is resistant to the antibiotic Vancomycin. it means this type of antibiotic is not working to kill the bacteria, moreover this type of bacteria is highly infectious that's why precaution is observed. </span>
You might be interested in
URGENT!!!
vitfil [10]

Answer:

<h3>Peripheral nervous system</h3>

The peripheral nervous system (PNS) is divided into the somatic nervous system and the autonomic nervous system. The somatic nervous system (SoNS) is the part of the peripheral nervous system associated with the voluntary control of body movements via skeletal muscles.

6 0
2 years ago
Sugars are large, hydrophilic molecules that are important energy sources for cells. how can they enter cells from an environmen
Arte-miy333 [17]

The correct answer is by facilitated diffusion.  

The procedure of continuous passive transport of ions or molecules through a semi-permeable membrane with the help of particular transmembrane integral proteins is known as facilitated or passive-mediated transport or facilitated diffusion.  

It is a modification of osmosis incorporating a proteinaceous channel via which an extracellular solute can enter a cell in the absence of energy.  


8 0
3 years ago
Explain how a tree is considered living it doesn't move
zheka24 [161]
A tree is considered living because it takes in nutrients like other living things. The tree is also made up of cells which all living things are made up of. Trees can also produce offspring. Just like any other living thing.
5 0
3 years ago
To a large extent, the activity of kidneys is controlled by ________________ .
Evgen [1.6K]
C. The Composition of your blood 

8 0
2 years ago
I need help with the mRNA to the Amino Acid part...
alexgriva [62]

Answer:

The amino acids produced from sequence are

AUG       Met  (Methionine )

AAC       Asn (Asparagine )

CAU       His (Histidine )

UCA       Ser (Serine )

GUA       Val (Valine )

UGG       Trp (Tryptophan )

Explanation:

4 0
3 years ago
Other questions:
  • Unlike the cell membrane, the cell wall is
    8·2 answers
  • The Milky Way is a _____ galaxy.
    5·2 answers
  • How did sir Francis basic laws of science should be determined?
    7·1 answer
  • I got a few questions and not a lot of point so please answer .-.
    7·2 answers
  • Chief cells secrete inactive pepsinogen in order to prevent acid erosion inside of the chief cells. True or False
    9·2 answers
  • “which of the biogeochemical cycles does not utilize the atmosphere?”
    9·1 answer
  • What do many ecologists feel is necessary for an area to be classified as a forest?
    7·1 answer
  • During the process of DNA replication, the whole molecule gets copied in the [A] phase of the cell cycle. The DNA strands are se
    13·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • There are 22 amino acids used within the human body. How can these 22 molecules be used to make hundreds of thousands of differe
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!