Below are the choices, the answer is no. 3:
1) The virus was descended from a common ancestor of bird, pig, and human flu viruses.
2) The infected individuals happened to be infected with all three virus types.
3)Related viruses can undergo genetic recombination if the RNA genomes mix andmatch during viral assembly.
4)The human was likely infected with various bacterial strains that contained all three<span>RNA viruses.</span>
The head<span> (or cephalic) region has five pairs of </span>appendages<span>. The antennules are organs of balance, touch, and taste. Long antennae are organs for touch, taste, and smell. The mandibles, or jaws, crush food by moving from side to side.</span>
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
<span>Base on a study that was undertaken in order to compare the
respiratory responses of hypnotized and non-hypnotized subjects to certain
instructions. According to a study, the 16 male volunteers were allocated to a
random experimental group to be hypnotized or to a control group. Baseline
measurements were taken at the start of the experiment. Analyzing the data,
researchers noticed that the baseline breathing patterns of the two groups were
different; One explanation proposed for this unexpected experimental the
difference of the group was more excited in the anticipation of the experience
in being hypnotized.</span>
They're strong and are good at keeping the sea out long-term, however they're really expensive
