1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blizzard [7]
4 years ago
6

Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC Complementary Strand:

Biology
1 answer:
Tomtit [17]4 years ago
3 0

Answer:

I'll break this into threes so its easier to read;

TTC ATG CTA GCT ACG TGT ACG TAC CGA TGC G

Explanation:

In DNA, the A bases goes with the T bases, and the C bases go with the G bases.

You might be interested in
What environmental conditions induce oxygen to bind to hemoglobin?
Gemiola [76]
An environment high in carbon dioxide and high in oxygen induce oxygen to bind to hemoglobin. Another factors are an environment under high pressure and an environment under low pressure. 
4 0
4 years ago
Read 2 more answers
Please tell me. What is the consequences of environmental change on different species?
Mandarinka [93]

Answer:

Climate change leads to a loss of species

Global warming resulting from human emissions of greenhouse gases. The consequences include habitat loss; shifts in climatic conditions and in habitats that surpass migrational capabilities; altered competitive relationships.

Explanation:

5 0
3 years ago
Read 2 more answers
4. Which types of foods contain which types of macromolecules? Is one type of macromolecule healthier to eat than another? Why d
Leokris [45]
Specifically, we tested for the presence of lipids, proteins, polysaccharides, and monosaccharides in samples of potato, oil, milk, sugar, egg, rice, tofu, bread, and glucose. It is important to know about the presence of different types of macromolecules in our food because it is important. Google
3 0
3 years ago
Communities within ecosystems are established through the process of ____.
andrew11 [14]

Answer:

D

Explanation:

7 0
2 years ago
Read 2 more answers
Which process is the total of all the chemical reactions in an organism
Leno4ka [110]
ATP or NADAP which is cycled
3 0
3 years ago
Read 2 more answers
Other questions:
  • Can someone please give me a question about genetics and heredity!
    10·2 answers
  • Give two examples of non-native species that have been introduced deliberately and accidentally
    13·1 answer
  • Which factor presents the greatest threat to biodiversity?
    14·1 answer
  • A particular species of seabird has a mutation in the gene pool that gives it a bigger beak. Individuals with this mutation can
    7·2 answers
  • I need help ASAP!<br> -<br> -<br> -<br> -<br> -<br> -<br> -<br> -
    9·1 answer
  • What are two key characteristics of cancer cells?
    8·1 answer
  • Please help me it’s due tomorrow
    12·1 answer
  • the nuclear envelope fragments, the centrosomes move apart from one another, and the chromosomes begin to move during which phas
    5·1 answer
  • How can bacteria be harmful? Select all that apply.
    10·1 answer
  • Question 9 (Multiple Choice Worth 2 points)
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!