1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blizzard [7]
4 years ago
6

Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC Complementary Strand:

Biology
1 answer:
Tomtit [17]4 years ago
3 0

Answer:

I'll break this into threes so its easier to read;

TTC ATG CTA GCT ACG TGT ACG TAC CGA TGC G

Explanation:

In DNA, the A bases goes with the T bases, and the C bases go with the G bases.

You might be interested in
When NADH donates electrons to protein complex 1 (embedded in the mitochondrial membrane) during respiration, protein complex 1
Goshia [24]

Answer:

Electron carriers of the electron transport chain

Explanation:

NADH reduces the electron carrier by donating an electron, releasing NADH+.

4 0
3 years ago
Biogenic minerals are minerals produced by living organisms. Two commonly seen biogenic minerals are , which is often produced b
goblinko [34]

Answer:

The preferable words for the fill in the blanks will be -  

Aragonite, calcite

Explanation:

  • Biogenic minerals are minerals produced by living organisms. Two commonly seen biogenic minerals are  <u>aragonite</u>, which is often produced by coral and other invertebrates, and  <u>calcite</u>, which often makes up the shell material of mollusks such as clams.
  • Biogenic minerals are the mineral substances that are produced by geologic processes. For living organisms, it is their most commonly produced byproduct.
  • E.g; vertebral bones, shells of Oyster, mussel, and clam (aragonite), etc.

8 0
4 years ago
2. What kind of effect does weather have on an ecosystem? How does it
andrew-mc [135]

Explanation:

Climate change can alter where species live, how they interact, and the timing of biological events, which could fundamentally transform current ecosystems and food webs.

3 0
3 years ago
A group of college students working on a project on bio-gas have found some bacteria in the bio-gas plant. These bacteria can ut
dedylja [7]
I beleive it would be probacteria

6 0
3 years ago
Describe the basic functions of animal body systems.
IgorC [24]

Answer:

The heart pumps blood through the circulatory system, delivering needed materials (glucose, oxygen) and picking up waste (carbon dioxide) from cells all over the body. Organs systems work together to efficiently and effectively provide all body cells with their basic needs to carry out life functions. 

4 0
3 years ago
Other questions:
  • What name is given to the bond between a hydrogen atom and and an oxygen atom within a single water molecule?
    9·1 answer
  • What would happen if most of the forests of Earth were cut down?
    14·1 answer
  • Which two substances bind using a lock-and-key mechanism?
    12·2 answers
  • The formation of photochemical smog is a result of a series of reactions between chemicals in the atmosphere and light. Which of
    10·1 answer
  • During what the offspring grows from the body of the parent.
    14·1 answer
  • What's the different metaphase 1 of mesious and metaphase of mitosis?
    5·1 answer
  • What's greater 10,000 cm or 1 kilometer
    15·2 answers
  • If a somatic cell has 46 chromosomes, how many chromosomes will you find in the daughter cells, after mitosis?
    7·1 answer
  • Northern elephant seals were hunted to the point that their population size was reduced to as few as 20 in the late 1800s. Since
    13·1 answer
  • How do many human activities influence the amount of atmospheric carbon
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!