1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zloy xaker [14]
3 years ago
13

What causes a valley breeze?

Biology
2 answers:
Oxana [17]3 years ago
8 0

rapid warming of the valley floor

Norma-Jean [14]3 years ago
5 0

Answer: The sides of the valley heating more quickly than the air around it

Explanation: Apex

You might be interested in
4.07 QUIZ ASTRONOMY <br> Through expanding, some galaxies are_______ with us?
lianna [129]
Through expanding, some galaxies are on a collision course with us.
7 0
3 years ago
Food webs show the flow of what between one type of organism to the next?
monitta

Answer:

yeah

Explanation:

6 0
3 years ago
Brainliest!!!!
Korvikt [17]

after the evolution of the first living cells, fermentation wasn't needed, because aerobic respiration was now doable, since there was more oxygen in the air now. also, as the temperature increases, it becomes more energy consuming to conduct fermentation over aerobic respiration.

Hope this helps :)

4 0
4 years ago
Which of the following is an example of a host organism?
kodGreya [7K]

Answer:

c. a dog with fleas

Explanation:

the answer is c

5 0
4 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Other questions:
  • Which of the following scientists contributed to the current understanding of<br> genetics?
    11·1 answer
  • ____ fitness is a medical term describing the effect of exercise on body systems and disease prevention.
    13·1 answer
  • What is any single living thing called?<br><br> population<br> organism<br> community<br> ecosystem
    10·1 answer
  • Please Help!!
    10·1 answer
  • what causes precipitations at front . "A" rising cold air. "B" rising warm air."C" increasing air pressure."D" increasing temper
    9·2 answers
  • A person undergoes hypnosis, and her hand is put in ice. She does not show signs of being in pain. Which of these statements is
    5·1 answer
  • Why do many Africans not have indoor plumbing?
    12·1 answer
  • Where is pryuvate made in the cell
    12·2 answers
  • How does smoking cause bladder cancer? Write a concise answer to this question using scientific language effectively
    12·1 answer
  • During photosynthesis, the energy used to pump protons comes from ___________, whereas in cellular respiration it comes from ___
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!