1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Irina-Kira [14]
2 years ago
7

Diagram by Explore Learning

Biology
1 answer:
Hoochie [10]2 years ago
5 0

Answer:

b 463.455. yeeeeeeeeee

You might be interested in
Select all that apply. For the photosynthesis process to occur, a plant needs _____. sunlight chlorophyll nitrogen carbon dioxid
Volgvan
The answer is sunlight, chlorophyll, carbon dioxide and water.

In the photosynthesis plants use sunlight as an energy and convert it into chemical energy stored in carbohydrates. Carbon dioxide and water are used for carbohydrate synthesis. This process occurs in the chloroplasts containing chlorophyll, which is necessary for absorbing energy from sunlight. 
5 0
3 years ago
Which of the following statements about the role of ATP in cell metabolism is true?
marishachu [46]
B. A form of energy coupling refers to using the release of energy from exergonic hydrolysis of ATP to initiate other endergonic reactions for cellular metabolism.
5 0
3 years ago
Read 2 more answers
From the Local Connections section, what people did you see out in the middle of the Namib desert?
BartSMP [9]

Answer: Baboon, Leopard, Cheetah, Brown and Spotted Hyena, Klipspringer, Springbok, Steenbok, Cape and Bat Eared Fox, Hartmann's Zebra, as well as many insects, reptiles, small mammals and even wild Desert Horses

Explanation:

7 0
3 years ago
How can we control the laser light show to stop it from hitting the crowd
kicyunya [14]

Answer:

just turn it off

Explanation:

8 0
3 years ago
Read 2 more answers
What reflects both genetic and environmental influences?
solong [7]
An individuals phenotype
4 0
3 years ago
Other questions:
  • [1] Tia and Jackie are partners in science class. [2] They have a big project to complete and are having trouble agreeing on an
    15·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Mendelian inheritance states that traits are determined when offspring receive for each trait from . Traits can be , which means
    6·2 answers
  • The decline of anchovies off the coast of Peru is most closely linked with which of the following human activities? A) global wa
    5·2 answers
  • When scientist compare two or more object what are they looking for?
    12·1 answer
  • 6. During self-pollination in seed plants, pollen grains (1 point)
    7·1 answer
  • Select examples of energy changing forms. Select the THREE answers that are correct.
    12·1 answer
  • The two types of Earth's crust are oceanic and ______________________. *
    7·1 answer
  • In some cases, a trait is determined by multiple alleles interacting. in rabbits, coat color is one of those traits. Therefore
    5·1 answer
  • In order to use amino acids as fuel, ____________ must occur. This process results in the formation of a(n) ____________ .
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!