1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marysya12 [62]
2 years ago
15

What should the Oreos and mice researchers do next to increase the credibility of their research?

Biology
1 answer:
docker41 [41]2 years ago
6 0

Answer: The should gather all the data the collected on the Oreos and mice and make sure all of there data is still factual information.

You might be interested in
Eukartyotic cell are more complex than prokaryotic cell
Elis [28]

Answer:

Eukaryotic cells are generally larger and more complex than prokaryotic cells. They also contain a variety of cellular bodies called organelles. The organelles function in the activities of the cell and are compartments for localizing metabolic function.

Explanation:

8 0
1 year ago
Cattle on an open range, in some areas, may compact fragile soils while grazing. This can damage plant roots, leading to fewer,
sp2606 [1]

Answer:

The given situation is an example of the <u>Positive feedback loop</u><u>.</u>

Explanation:

Positive feedback is the phenomenon in which the effects of the small disturbances on a particular system can result in an increase in the perturbation magnitude. Positive feedback increases the input and causes instability in the system. Therefore, it refers to positive loop gain about closed loop of the cause and effect.

<u>Therefore, the given situation is an example of the </u><u>Positive feedback loop</u><u>. </u>

3 0
2 years ago
11. Which statement fits the heliocentric model of the solar system?
Umnica [9.8K]

Answer:

The Sun revolves around Earth.

5 0
2 years ago
A nurse is caring for a child with meningococcal meningitis. what clinical finding does the nurse expect to encounter during a p
Katyanochek1 [597]
<span>Answer: "Purpuric skin rash" nurse expect to encounter during a physical assessment.</span>
8 0
2 years ago
Which of the following is an example of an antigen that might be recognized by the immune system of an individual?
Anvisha [2.4K]

Answer:

Is there a choice for the following?

Explanation:

6 0
3 years ago
Other questions:
  • Which amino acid is present in higher amounts than glycine in the samples?
    14·1 answer
  • Why is ice cooler than water?
    7·1 answer
  • Cora is a long-term user of antipsychotic medication and was once misdiagnosed with a medical condition that mimics tardive dysk
    10·1 answer
  • If energy is not from above and not from the sun then where do some organisms obtain energy
    10·1 answer
  • What is the purpose of the uninoculated control tubes used in the oxidation fermentation test? why is it necessary to use two co
    5·1 answer
  • Oligosaccharides are long chains of lipids linked to proteins and phospholipids on the surface of cells.
    9·1 answer
  • The water on the Earth today has been sustaining life for millions of years. Please select the best answer from the choices prov
    14·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Helppp, i need this asap
    11·1 answer
  • What is the functions of the digestive, excretory, respiratory, circulatory, and lymphatic systems, and how do they interact to
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!