1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marysya12 [62]
3 years ago
15

What should the Oreos and mice researchers do next to increase the credibility of their research?

Biology
1 answer:
docker41 [41]3 years ago
6 0

Answer: The should gather all the data the collected on the Oreos and mice and make sure all of there data is still factual information.

You might be interested in
A forest is cut down to make room for a housing development. Which population is most likely to survive?
lilavasa [31]
C raccoons because they eat a wide variety because they can adapt more easily than other populations
6 0
3 years ago
Read 2 more answers
Charles Darwin observed a unique beak size and shape in the finch population of each of the Galapagos Islands that he visited. W
Volgvan
In this question, there are no options given to choose from. So i would answer this question based on my knowledge. The most likely cause of the observed variation is adaptation and evolution. The birds of that island adapted to the food source and then they evolved as per the requirement of the place and food source.
5 0
3 years ago
The correct functions of your lungs contribute to the normal ph level of between 7.35 and 7.45. if your lungs do not exchange an
Delicious77 [7]

The reading of the blood pH value of 6.4 indicates a health issue because of the pH value. It is because the concentrations of H+ ions in the body becomes 10 times more than the usual level in the body.  

The pH of the blood becomes less than 7.35 due to enhanced production of hydrogen ions by the body or the incapability of the body to produce bicarbonate ions in the kidney, the condition is known as metabolic acidosis that eventually results in acidemia.  


8 0
3 years ago
Which statement is NOT true about the plasma membrane?
Ulleksa [173]
Where are the choices ?
4 0
3 years ago
During a trip to the Galapagos Island what observation led Charles Darwin to suspect that organisms change overtime
V125BC [204]
The answer should be "Island finches resembled mainland finches, but were not the same species." 
7 0
3 years ago
Other questions:
  • (Mendelian Genetics) Consider three gene pairs Aa, Bb, and Cc. The uppercase letter is the dominant allele and each gene pair as
    7·1 answer
  • What process changes an organism by introducing novel DNA into the organism?
    8·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Describe the formation for a meander
    6·1 answer
  • The shape and size of a bird's beak would most likely be affected by what environmental limiting factor ?
    15·1 answer
  • What is energy coupling?
    13·1 answer
  • Transcribe the DNA<br> 5' GGCTAATTCGAT 3<br> SHARK
    12·1 answer
  • Which molecules does a cell need from food to make these membrane
    6·1 answer
  • HELP PLS!!!!!!!!!!!!!
    12·1 answer
  • Define carbohydrate and provide an example.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!