Answer:
B. an asteroid belt lies between them.
Explanation:
The asteroid belt is the circumstellar disc in the Solar System located roughly between the orbits of the planets Mars and Jupiter. It is occupied by numerous irregularly shaped bodies called asteroids or minor planets.
Its that food dropped on the ground is safe to eat and will not be covered in germs as long as its picked up within 5 seconds after its dropped.
Answer: D
Explanation:
photosynthesis - takes in water, energy from the sun, and carbon dioxide and releases oxygen and glucose (sugar)
respiration - takes in glucose and oxygen, and releases water and carbon dioxide and energy
they are basically the opposite
HAVE A GREAT DAY :)
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
Explanation:
In the water cycle, evaporation occurs when sunlight warms the surface of the water. The heat from the sun makes the water molecules move faster and faster, until they move so fast they escape as a gas. Once evaporated, a molecule of water vapor spends about ten days in the air.
