1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sladkih [1.3K]
3 years ago
12

Does global temperature effect the number and severity of tornadoes? What would be the control group or constant for this experi

ment?
Biology
1 answer:
Studentka2010 [4]3 years ago
4 0
Yes considering tornadoes are formed by certain global temperatures.
You might be interested in
Consider the models of cell reproduction. Evaluate the statements and select ALL that are NOT supported by the models.
Novosadov [1.4K]

Answer and Explanation:

The cell division cycle is responsible for increasing and maintaining cell number and size. This cycle is an essential feature of living organisms. There are four phases of cell division mitotic phase (M phase), growth phase 1 (G1), growth phase 2 (G2), and synthesis phase (S). One phase of the cell cycle ends, and the other starts; this is named a phase transition—a unidirectional alteration in the cell cycle phases. During G1, G2, and S phase cell grows and during the M phase cell divides. There are two models of cell reproduction as the clock model and the domino model. The domino model implies that cell division phases must occur in a distinct order and at a definite time. The domino model recommends that the cell cycle events are independent, while the clock model shows that the effectiveness of mitosis entrance was not persuaded by other actions.

5 0
3 years ago
Read 2 more answers
Organisms undergo many different processes in order to be able to store energy and utilize that energy. Through which of th
kondor19780726 [428]

Through "cellular respiration" process energy is stored in the form of glucose.

<u>Answer:</u> Option A

<u>Explanation:</u>

The series of metabolic reactions and mechanism take place in organism ranging from microscopic bacteria to large organisms cells in order to transfer biochemical energy from food nutrients (stored in glucose form which is transferred) to adenosine triphosphate (ATP) and then waste product is also released, the whole process is known as "cellular respiration".

The energy required for ATP synthesis extracted from the breakdown of foods and phosphocreatine (creatine phosphate). It is stored inside muscle cells because phosphocreatine is readily available to produce ATP quickly.

6 0
3 years ago
What type of functions to proteins have for us
nydimaria [60]

Answer:

Proteins play a role in transport, enable movement, provide structure and support, and help make chemical reactions happen.

Explanation:

I'm not quite sure if this was your question, but these are the functions of protiens.

4 0
4 years ago
What Provides long-term energy storage for animals
Reptile [31]
Lipids provide long term energy storage 
3 0
3 years ago
For children with most physical disabilities and other health impairments, a common cause of academic difficulties is
Ber [7]

For children with most physical disabilities and other health impairments, a common cause of academic difficulties is erratic or irregular school attendance.

Class attendance or school attendance is very important for your academic carrier because if you are not able to attend the class, you did not learn anything, you did not finish your homework etc. and when the exams came you did nothing. So, the children with physical disabilities or other health issues mostly misses the class due to health issues, and this irregular attendance causes difficulties in academic carrier.

<span> </span>

5 0
3 years ago
Other questions:
  • Describe cell specialization. Why is it important that cells are able to specialize?
    6·2 answers
  • Using an electron microscope, a scientist identified these cell structures in an unknown organism: mitochondrion, nucleus, cell
    10·1 answer
  • Define metabolism. explain how catabolism and anabolism contribute to metabolism and how catabolism and anabolism differ from ea
    15·1 answer
  • Some major factors used to determine the differences between sunset desert climate zones are
    7·1 answer
  • Primary succession ______.
    5·1 answer
  • In the diagram of the earths interior, where does the material that forms volcanoes originate
    8·2 answers
  • A _______ is a segment of DNA that directs the development of some inherited traits and it has different forms called __________
    14·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Compare lysosomes and vacuoles to the excretory system.<br> They both ...
    5·1 answer
  • ANYONE?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!