1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fiesta28 [93]
3 years ago
13

Choose the answer that has these events of protein synthesis in the proper sequence 1. The first tRNA with Met binds to the P si

te 2. A peptide bond forms between the new amino acid and a polypeptide chain 3. tRNA comes in to the A site with a new aa, 4. A small ribosomal subunit binds with mRNA 5. tRNA in the P site leaves and the tRNA from the A site translocates to the P site
Biology
1 answer:
Simora [160]3 years ago
5 0

Answer:

4. A small ribosomal subunit binds with mRNA;

1. The first tRNA with Met binds to the P site;

3. tRNA comes in to the A site with a new aa;

2. A peptide bond forms between the new amino acid and a polypeptide chain;

5. tRNA in the P site leaves and the tRNA from the A site translocates to the P site.

Explanation:

The first step in translation i.e. protein synthesis is attachment of small ribosomal subunit i.e. 30S subunit with mRNA. Soon after that a tRNA charged with Met binds to the P site of 30 S ribosomal subunit. To this complex further 50S ribosomal subunit binds. Together all these components form '70 S initiation complex". Since this complex already has one amino acid (tRNA with Met) at the P site, in order to create peptide chain another tRNA charged with amino acid must enter the complex. The upcoming tRNA enters the initiation complex at A site. Next, due to the peptidyl transferase activity of large ribosomal subunit i.e. 50S subunit a peptide bond is formed between the amino acid at P site and amino acid at A site. Now since peptide bond has already been formed tRNA at P site is useless so it has to be expelled from the initiation complex via exit site. As soon as this tRNA is expelled, the tRNA which was at A site translocates into P site so that a new tRNA charged with another amino acid could enter the A site for further elongation of peptide chain.

You might be interested in
Can someone please help me with this
sertanlavr [38]

Answer:

nucleus-red, membrane-most outer part in of cell in black, centrioles- purple, left the spindle fibers

3 0
3 years ago
Which statement best compares a trace fossil to a fossil that forms as a result of an entire organism being trapped in amber?
MatroZZZ [7]

Answer:

it is C

Explanation:

5 0
3 years ago
In sexually reproducing organisms, genes are transferred via _______________? A) budding
Nonamiya [84]
In sexually reproducing organisms, genes are transferred via <span>egg and sperm 

In short, Your Answer would be Option C

Hope this helps!</span>
3 0
3 years ago
Read 2 more answers
A/An ______________________________ is a specialized radiographic examination of the uterus and fallopian tubes.​ Question 94 op
Mademuasel [1]

Answer:

Hysterosalpinography

Explanation:

It is Hysterosalpingography because it is an x-ray examination of uterus and fallopian tubes that uses a specific type of x-ray called fluoroscopy and a radiopaque material. It is use to examine women who find it difficult in getting pregnant to examine the shape of the uterus.

4 0
3 years ago
In the ________ temperature scale, water freezes at 0° and boils at 100°.
zepelin [54]

Answer:

  1. Celsius is the correct answer
5 0
3 years ago
Other questions:
  • Because of the large heat of __________ of water, the evaporation from a liquid surface is a very effective cooling mechanism. T
    10·2 answers
  • A tree grows and increases its mass explain why it is not a violation of the law of conservation of mass
    5·1 answer
  • Describe relationship between frequency, wavelength, and energy as you move up and down the spectrum.
    7·1 answer
  • When one recognizes a friend at a party, which brain area is the first to receive the information from one's visual receptors?Gr
    15·1 answer
  • Innate behavior -- a behavior that is present at birth
    13·2 answers
  • Select the correct answer.
    6·2 answers
  • Explain some of the processes involved in a scientific investigation.
    5·2 answers
  • Which example best demonstrates diffusion?
    5·1 answer
  • Please answer if u know. dont answer if u dont. Corrrect answer gets branliest
    7·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!