1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
worty [1.4K]
3 years ago
8

Which list shows three components of an organ system in order of least complex to most complex?

Biology
2 answers:
kolbaska11 [484]3 years ago
7 0

Answer:

I believe its muscle cell, muscle tissue, stomach

Explanation:

The order for organ systems from least complex to most complex is: Cell, tissue, organ, organ system. Hope this helps

Lesechka [4]3 years ago
5 0

Answer:

the answer is C/the third listings

Explanation:

You might be interested in
In eukaryotes, where do transcription regulators bind?
Liula [17]

Answer:

8012088061

Explanation:

6 0
2 years ago
All cells have _____. (Select all that apply.) an outer membrane or plasma membrane cytoplasm a cell wall a nucleus protoplasm l
alexgriva [62]
Plasma membrane
cytoplasm
nucleus
protoplasm
3 0
3 years ago
Read 2 more answers
CAM photosynthesis limits CO2 fixation to nighttime hours in order to (A) allow water to enter leaf spaces during the daylight h
bixtya [17]

Answer:

(B) open stomata only at night, limiting water loss because of heat and low humidity.

Explanation:

CAM plants are found in the regions characterized by very hot and dry environmental conditions. These plants reduce the water loss through transpiration by exhibiting CAM photosynthesis.  

They open the stomata during night time when the air is cooler and rich in moisture. They take in CO2 during night time and fix it into the oxaloacetate which in turn is converted into malate and is stored in the vacuoles.  

During day time, stomata remain closed to prevent water loss and the CO2 trapped during night time (released by decarboxylation of malate) enter the Calvin cycle.

3 0
3 years ago
Name the stage of meiosis
inn [45]
I think it's A becuse the stageof meiosis is cytokinsis
8 0
3 years ago
Propose an experiment that would test if the RNA component of telomerase serves as a template to extend telomeres. A cell free s
IceJOKER [234]

Answer:

To study the importance of the RNA telomer element, we can evaluate it by generating an in vitro state where all the purified components are included, organizing two groups, one of them will have an RNAase and the other will not, if it is observed that the telomeres extend to the component of the RNA, in the set where there is no RNAase, longer telomeres could be observed, if there were no influence of the RNA, the length in both groups would be the same

7 0
3 years ago
Other questions:
  • A construction worker uses a hammer to drive a sharp nail into a concrete wall. What two simple machines is the construction wor
    5·1 answer
  • Fungi differ from plants in that they do not reproduce by seeds and lack
    7·1 answer
  • Bacteria disease may become difficult to cure when bacteria?
    8·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • A(n) _____ muscle action occurs when a muscle develops tension while lengthening.
    6·1 answer
  • The connection between transportation and the environmental impacts of urban areas.
    10·1 answer
  • Predict how a plant would be affected if its xylem is dysfunctional?
    6·2 answers
  • What three particles make up atoms?
    14·2 answers
  • Explain how the presence of coal-fired electricity plants can affect the ability of lakes to support life?
    6·1 answer
  • Cohesion of water molecules is due to?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!