1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Virty [35]
4 years ago
11

Can diseases be transmitted by intermediate hosts? I need an answer quickly

Biology
1 answer:
GenaCL600 [577]4 years ago
7 0

Answer:

yes

Explanation:

like in malaria the parasite plasmodium inhabits the salivary glands of the mosquito though it does not affect it before being transmitted to us by a bite where now we catch malaria

You might be interested in
What happens when a photon of light hits photosynthesis
Aliun [14]
A photon of light hits chlorophyll, causing an electron to be energized.
I found it on googIe
5 0
3 years ago
Read 2 more answers
Why were Wegener’s ideas about Continental Drift consider a theory?
Olin [163]
He had no proof to back up this theory and was rejected by the scientific community. People only found evidence after he died. Please make me brainliest
6 0
4 years ago
Describes what happens as carbon cycles through the environment. What takes carbon out of the environment? What things put carbo
Citrus2011 [14]

Answer:

Carbon moves through Earth's ecosystems in a cycle referred to as the It is through carbon dioxide gas found in Earth's atmosphere that carbon enters the living parts of an ecosystem. ... To release the energy in food, organisms break down the carbon compounds—a process called respiration.

Photosynthesis removes carbon dioxide naturally—and trees are especially good at storing carbon removed from the atmosphere by photosynthesis. Expanding forests, restoring existing forests and managing forests to encourage more carbon uptake can leverage the power of photosynthesis to convert carbon dioxide in the air into carbon stored in wood and soils. The decompsition of the soil helps create a natural environment which keeps the trees healthy and continuously producing photosynthesis. Direct air capture is the process of chemically scrubbing combustionable carbon dioxide directly from the ambient air, and then storing it either underground or in long-lived products. This new technology is not unlike the carbon capture and storage technology for various emissions sources like power plants and industrial facilities. The difference is that direct air capture removes carbon from the atmosphere instead of consuming emissions.

Carbon dioxide is added to the atmosphere by human activities. When hydrocarbon fuels (i.e. wood, coal, natural gas, gasoline, and oil) are burned, carbon dioxide is released. During combustion or burning, carbon from fossil fuels combine with oxygen in the air to form carbon dioxide. Animals and plants need to get rid of carbon dioxide gas through a process called respiration.

Greenhouse gases have far-ranging environmental and health effects. They cause climate change by trapping heat, and they also contribute to respiratory disease from smog and air pollution. Extreme weather, food supply disruptions, and increased wildfires are other effects of climate change caused by greenhouse gases.If not for the greenhouse effect, Earth would be an ice ball. So, CO2 and other greenhouse gases are good—up to a point. But CO2 is so good at holding in heat from the Sun, that even a small increase in CO2 in the atmosphere can cause Earth to get even warmer.

Hope this helps :)

Explanation:

5 0
3 years ago
Which of the following is an example of reproductive isolation? two populations of finches that cannot produce viable offspring
OverLord2011 [107]

The correct answer is A. Two populations of finches that cannot produce viable offspring

Explanation:

Reproductive isolation is a biological and evolutionary phenomenon that prevents two species from successfully reproducing, this means they cannot produce offspring or the offspring is not fertile, even if these species had a common ancestor. Additionally, as a result of reproductive isolation, each species keeps its genes and features. This phenomenon is best exemplified in "Two populations of finches that cannot produce viable offspring " because this refer to the barriers for different species to reproduce or produce viable offspring, which is the focus of reproductive isolation.

6 0
3 years ago
41) a particular triplet of bases in the template strand of dna is 5' agt 3'. the corresponding codon for the mrna transcribed i
KiRa [710]

A particular triplet of bases in the template strand of DNA is 5' agt 3'. the corresponding codon for the mRNA transcribed is<u> 3' UCA 5'</u>

<u></u>

It serves as a link between DNA's genetic code and proteins' amino acid sequences.

The codons in the messenger RNA (mRNA) are complementary to the nucleotide sequence on the DNA template strand.

Then it controls the synthesis of amino acids with the aid of tRNA and ribosomes.

Its name, messenger RNA, refers to the fact that it carries genetic information. The single strands of adenine, cytosine, guanine, and uracil that make up the mRNA molecule are held together by a sugar phosphate backbone.

Two codons: His, Lys, Phe, Tyr, Asn, Asp, Cys, Gln, Glu, Codons Ile, STOP, and three ("nonsense"). Ala, Gly, Pro, Thr, and Val are the four codons. None of the five codons.

Learn more about mRNA:

brainly.com/question/24885193

#SPJ4

3 0
1 year ago
Other questions:
  • Plant hormonal regulation differs from animal hormonal regulation in that _____. plant hormonal regulation differs from animal h
    9·1 answer
  • What caused an increase in phosphorus pollution in Florida waters?
    13·2 answers
  • Why its important that skull joints cannot move
    9·1 answer
  • Which of the following statements about aldosterone is NOT correct?
    12·1 answer
  • Which of earth layers has the same chemical composition as the mesosphere
    13·1 answer
  • Severing a cat's reticular formation from higher brain regions causes the cat to:
    14·1 answer
  • What type of rock forms due to high pressure?
    13·2 answers
  • If there are five trophic levels, and at the bottom level (producers) 830,000 calories are available? How many calories are avai
    9·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Please Help!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!