1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maru [420]
3 years ago
8

Some substances but not other can cross the (blank) membrane of a cell

Biology
1 answer:
Orlov [11]3 years ago
6 0

The correct answer is :

Some substances but not other can cross the (blank ) membrane of a cell. The   blank is to be filled with either cell or plasma. Cell membrane or plasma membrane is the living boundary of a cell which is made of phospholipid. It is a semi-permeable or differentially permeable membrane. It only allows small and non-polar molecules to pass through it. It prevents polar ions or molecules to pass through it  

You might be interested in
1. In the digestive system, where are nutrients absorbed?
nirvana33 [79]

Answer:

1. Small intestine

2. A. Capillaries

3. B. Nervous system controls all other organ systems.

4. A. Controlling body temperature.

And hydration.

B. Producing sweat to regulate body temperature and get rid of waste.

5. C. Reproductive system.

6. Skeletal system

7. A

Explanation:

6 0
3 years ago
Do you think most traits are inherited the way mouse fur color is? Why do you think this is?
valentinak56 [21]

Answer:

No, traits are inherited from the offspring's parents. The offspring's traits are based off of the alleles of the parents. There is also a chance of a mutation in the genes.

Explanation:

7 0
3 years ago
What type of soil is most permeable
zavuch27 [327]
Sand should be your answer because it contains 5,0 premeability variation
7 0
4 years ago
Read 2 more answers
Which of the following statements about tuberculosis is FALSE?
german
A. It usually affects the digestive tract. is false. This is because although tuberculosis can affect it, most of the time it affects the lungs and respiratory system.
Hope that helped you.
5 0
4 years ago
Jessica isn't invited to a super bowl party her coworkers are throwing because she's a woman. jessica is experiencing ____ from
Dahasolnce [82]
The answer is A. Discrimination

I hope this helps!
8 0
3 years ago
Read 2 more answers
Other questions:
  • What does the term unzipping refer to in dna replication
    11·1 answer
  • Summarize the function of each structure in mitosis
    6·1 answer
  • What happens during a cross-over event?
    9·1 answer
  • Which part of a plant protects and ensures the survival of fertilized eggs?
    6·1 answer
  • Describe the path of an impulse associated with lifting your arm. What part of the brain starts this impulse?
    11·2 answers
  • Humans have a gene, T, that is involved in muscle formation of the tongue. Individuals homozygous for one allele can roll their
    10·1 answer
  • Describe how scientists use technology to determine if genes are 'turned on' or 'turned off'.
    13·1 answer
  • Why is a home heating system a good model for the way that the thyroid gland is controlled by the pituitary gland and hypothalam
    6·2 answers
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • From the moth’s point of view, is the ability to be seen an advantage (known as an advantageous trait) or disadvantage (known as
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!