1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
xxTIMURxx [149]
3 years ago
6

Each of the following is a function of the integumentary system except:

Biology
1 answer:
kramer3 years ago
4 0

Answer:

A. synthesis of vitamin C.

Explanation:

Integumentary system refers to the skin and its appendages. So it doesn't have the role to synthesis vitamin C, but it can synthesis  vitamin D through exposure to UV light. The major role of integumentary system is protective role (immuno defense-from infections, dehydration, temperature changes, protection of underlying tissue etc). It also contains many receptors (for pain, touch, temperature change) that detect environmental changes.

You might be interested in
Pieces of DNA that code for particular traits that can be inherited
erica [24]
Alleles

I had bio a while ago though so I could be wrong...
6 0
3 years ago
Read 2 more answers
______ make their own food by extracting compounds from the ocean.photoautotrophs,chemoautotrophs,cyanobacteria
Nezavi [6.7K]
<span>Both photoautotrophs and chemoautotrophs synthesize organic compounds from (inorganic) carbon dioxide, a process known as carbon fixation. Photoautotrophs get the energy to perform these reactions from light. Chemoautotrophs get it from electron donors such as hydrogen sulfide and ammonia. Cyanobacteria, by contrast, convert nitrogen from the atmosphere into ammonia, a process known as nitrogen fixation.</span>
4 0
3 years ago
A cheeseburger from a fast food restaurant contains 19 g of fat, 20 g of carbohydrate, and 28 g of protein. How many kcal of ene
Nikolay [14]

Answer:

which equals 360 cal for total energy

Explanation:

We simply get the sum of the product of each mass and caloric values.

Total energy = 19 g * 9 kcal / g + 20 g * 4 kcal / g + 28 g * 4 kcal / g

Total energy = 363 kcal

5 0
3 years ago
Which of the following are needed by all living things?
defon
I’m pretty sure it’s water, oxygen, and food. beacuse food provided both nutrients and an energy source.
4 0
3 years ago
What does the the pigs wearing green ribbons represent in animal farm?
Rama09 [41]
Pigs started wearing green ribbons on their tails on Sundays it was for the rejection of animalism.
8 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Most fungi carry on external digestion.<br><br> True<br> False
    11·2 answers
  • The ion imbalance known as ________ initially leads to ________ in excitable cells
    11·1 answer
  • How big (how many boxes total) will a two factor cross punnett square be?
    15·2 answers
  • Which of the following mutations would most likely affect a cows offspring
    6·1 answer
  • Gregor Mendel was an Austrian monk who lived in the 1800s. Mendel made many important discoveries related to genetics and heredi
    5·2 answers
  • How do u fix this sentence ''the man next door never goed to no partys.''
    5·2 answers
  • Which of the following is an example of the current impact DNA technology has on human health?
    5·1 answer
  • Is there anyone who can define SAP​
    11·1 answer
  • Which organism would be classified as a saprotroph?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!