1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IgorLugansk [536]
4 years ago
14

Why do intraplate earthquakes tend to be less frequent and smaller than earthquakes at plate boundaries?

Biology
1 answer:
Inga [223]4 years ago
6 0
Earthquakes on plate boundaries happen more because the plates all move in different directions in a tectonic environment so they collide against each other which makes them more frequent. Earthquakes rarely happen in intra-plate environments but along faults in normally stable interior of the plates. If this doesn't make sense, ask me to reword it for you !
You might be interested in
What is physical science
Vitek1552 [10]
The sciences concerned with the study of inanimate natural objects, including physics, chemistry, astronomy, and related subjects.
7 0
3 years ago
Read 2 more answers
A wolf eats a rabbit that eats grass. the wolf is a(n) ________. a wolf eats a rabbit that eats grass. the wolf is a(n) ________
Ira Lisetskai [31]
The wolf is a consumer. (secondary consumer specifically)

Consumer means the animals in a food chain which eats other animal / plant at a lower tropic level (position in food chain) for energy.

Detritivore are organisms that decomposes dead organic matter, and returning the broken down nutrients and matter back to the start of a food chain, which is for the producers.

Producers are usually green plants which make their own food from sunlight, by the process of photosynthesis, and we call the organisms that uses this kind of feeding (making food on their own) as autotroph.

Therefore, since the wolf feeds on rabbits for energy, and not carrying out photosynthesis nor decomposing other organisms for food, so the answer is consumer.
7 0
3 years ago
Which of the following statements is not consistent with primary lactose intolerance?a primary lactose intolerance is more commo
jek_recluse [69]
B. Primary lactose is often seen in crohn's disease!
6 0
3 years ago
The awareness of being masculine or feminine as those traits are defined by culture.
Nina [5.8K]
It is very true that masculinity and femininity are very strongly dependent on the society in which these terms are used. While there are genetic differences underlying the phenotype of being more masculine (having a bigger jaw, more hair on the body), there are also a lot of societal factors determining what is considered to be masculine and what feminine in a society. 
5 0
3 years ago
Read 2 more answers
How do animals use sex, besides procreation
dybincka [34]

Animals use this type of physical act to reproduce another type of their species. Mostly to impress or make the type of gender to fall in love.

7 0
3 years ago
Other questions:
  • How are rain forests related to wind patterns?
    11·1 answer
  • Notice the population of beetles. The allele for color is seen on their backs: green and brown alleles. Over time, through rando
    5·1 answer
  • Cancer, which can be considered as unregulated cell division, often results from mutations in proto-oncogenes and tumor suppress
    15·1 answer
  • John conducted an experiment during his science class and he didn't get the results that he had predicted. Which of the followin
    14·1 answer
  • In which part of the nephron are sodium and chloride ions actively reabsorbed?
    6·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Which of the following molecules get recycled during photosynthesis?
    14·1 answer
  • WILL MARK BRAINLYEST<br> PLEASE HELP WITH THIS
    13·1 answer
  • Are humans predators in their ecosystem? explain
    6·1 answer
  • In cold areas, people light a campfire to keep themselves warm. Why do we feel warm near a campfire?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!