1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jeka57 [31]
3 years ago
10

What is the 1st step of virus infection?

Biology
2 answers:
Anna71 [15]3 years ago
7 0
Shannon is correct. I think of it as a microscopic spider. Imagine you touch something at Walmart and get your hands infected you wipe your nose with your hands. The virus enters the nose or wherever you let it go to. It crawls into one cells(now host cell) it injects genetic material of the virus into the host cell, the host cells the explodes and the micro-microscopic particles spread onto more and more cells and break those. While your immune system tries to defend you against them, sometime your immune system wins and you don’t get sick but sometime is looses and that is how we get sick.
lana66690 [7]3 years ago
6 0

Answer:

first step of the virus is to find a host and attaches itself to the host, goes into and attacks the body

You might be interested in
A biologist collected 1 gallon of pond water and found 50 paramecium. If the lake
iren [92.7K]

Answer:

50000

Explanation:

number of paramecium in 1 gallon of water = 50

number of paramecium in 1000 gallons of water =

1000× 50 = 50000

8 0
2 years ago
Using complete sentences, compare and contrast the terms living and biotic. In your response, illustrate using examples and appr
Tems11 [23]
Biotic factors are all of the “alive” factors in the environment which includes all living organisms. Abiotic factors are opposite, are “non alive” factors which may include water,soil,air,rocks,and etc.
6 0
2 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Put the following steps in the correct order from 1-9
storchak [24]

Answer:

transcription of mRNA from DNA

small ribosomal subunit binds to mRNA

initiation complex formed with addition of large ribosomal subunit

translocation

codon recognition (non-initiating site)  

peptide bond formation

ribosome reads a stop codon

polypeptide chain is released from the P site

ribosomal subunits dissociate

Explanation:

The above describes the process of translation in the ribosome. After transcription of DNA to mRNA, the mRNA is taken to the ribosome to undergo translation, here the mRNA binds to the small ribosomal subuits and to other initiation factors; binding at the mRNA binding site on the small ribosomal subunit then the Large ribosomal subunits joins in.

Translation begins (codon recognition; initiating site) at the initiation codon AUG on the mRNA with the tRNA bringing its amino acid (methionine in eukaryotes and formyl methionine in prokaryotes) forming complementary base pair between its anticodon and mRNA's AUG start codon. Then translocation occurs with the ribosome moving one codon over on the mRNA thus moving the start codon tRNA from the A site to the P site, then codon recognition occurs (non-initiating site again) which includes incoming tRNA with an anticodon that is complementary to the codon exposed in the A site binds to the mRNA.

Then peptide bond formation occurs between the amino acid carried by the tRNA in the p site and the A site. When the ribosome reads a stop codon, the process stops and the polypeptide chain produced is released and the ribosomal subunits dissociates.

6 0
3 years ago
Examine the diagram provided. Based on the diagram, which organisms compete for food resources?
otez555 [7]

Answer:

Antelopes and Squirrels depend on grass (a food resource), and in turn the predators (hawks, mountain lions, coyotes) depend on the herbivores.  

Explanation:

Hope this helps!

5 0
2 years ago
Read 2 more answers
Other questions:
  • In 2005 the Northwestern University women's lacrosse team won an NCAA championship and was invited to the White House to receive
    5·1 answer
  • 3. What is the acceleration due to gravity on Earth?—Answer must include number and its unit (This is a constant number used in
    11·1 answer
  • Describe the factors considered in an analysis of a person’s or population’s ecological footprint.
    10·1 answer
  • An oncogene is: Select one:
    15·2 answers
  • Which environmental factor could lead to a decrease in genetic variation in a population of tuna?
    15·1 answer
  • How would plants and animals in the rainforest get affected
    15·1 answer
  • Match the following terms and definitions. 1. two or more units are added together to form a new compound law of mass action 2.
    10·1 answer
  • The business cycle illustrates the long-run fluctuations of ___.
    12·1 answer
  • Which is an example of a scientist using a physical model to describe a
    12·1 answer
  • ________ can reduce dopamanergic activity and manic episodes.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!