1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gtnhenbr [62]
3 years ago
9

Is the tube that carries blood, oxygen, and nutrients from the placenta to the developing child?

Biology
1 answer:
Nitella [24]3 years ago
7 0
Umbilical vein transports blood rich in oxygen and nutrients from the placenta to the fetus. The unpaired umbilical vein is a vein present during fetal development and it transports the nutrient- and oxygen-rich blood from the placental villi via the umbilical cord to the embryo. The umbilical vein is connected to the two intraembryonic umbilical veins.
You might be interested in
Is often in the news, the opposite extreme can also lead to globa
-Dominant- [34]

Answer:

if you have ah party wen we are pouring for the house and I

3 0
2 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
A 15 year old girl was 1.55m tall. She was 47.6cm long at birth. Calculate how much she has grown since birth in metres.
sweet [91]

Answer:

1.07

Explanation:

1.55m =155cm so when you subtract 47.6 cm you get 107.4 cm which is equal to 1.074m

5 0
3 years ago
Who performed classic experiments that supported the semiconservative model of DNA replication? (A) Watson and Crick (B) Meselso
loris [4]

"Mathew Meselson and Franklin Stahl performed classic experiments that supported semiconservative nature of DNA replication in 1985."

A band of hybrid 14N and 15N DNA was produced as a result of the DNA's initial duplication in a 14N medium. The conservative replication mode was so abandoned. "Based on their observations and experimental results, Meselson and Stahl concluded that DNA molecules can replicate semi-conservatively."

One original DNA serves as a template for the production of two DNA copies during conservative replication. One of these two is made entirely of fresh DNA, while the other is made of strands from old DNA. In semiconservative replication, the parent strand is used to make two copies of the DNA, each of which contains one original strand and the other new strand.

To learn more about conservative and semiconservative here,

brainly.com/question/20412083

#SPJ4

5 0
2 years ago
Purple petal color in pea plants is dominant to white petal color. Two heterozygous pea plants are crossed. What ratio of the of
Paladinen [302]

Mendel crossed the dominant purple colour flowered plant with the recessive white colour flowered plant. The F 1 generation produced the heterozygous purple colour flowered (Pp) plants. When two heterozygous pea plants (Pp) are crossed in the F2 generation represented by Pp x Pp, the gametes formed are P and p. Out of the offspring produced, 3 are purple colour flowered plants and 1 is white colour flowered plant. Thus the phenotypic ratio is 3: 1 with one out of four plants being white colour flowered pea plant. When expressed in percentage it is 25%.

4 0
3 years ago
Read 2 more answers
Other questions:
  • The music of the Classical era reflects the principles of 
    7·1 answer
  • The _______ system consists of nerves that transmit impulses back and forth between the central nervous system, the skeletal mus
    12·1 answer
  • How do you know that bone is living tissue?
    8·1 answer
  • Which molecule is classified as organic?
    6·1 answer
  • Put the following in order by size from largest to smallest: nucleus, gene, chromosome
    10·1 answer
  • Both slicing an apple and a chemical change such as cooking and I cannot be reversed. However why is slicing a apple still consi
    6·1 answer
  • HELPPPP!!! HELPPPPP!! PLSSSS!! ASAPPPP
    15·1 answer
  • 3. What happens to the amount of Ammonium Chloride (NH4)Cl that can dissolve as the temperature decreases?
    14·1 answer
  • Is it still considered cannibalism if you eat yourself (like a part of yourself)
    14·1 answer
  • Explain why there is a greater efficiency in supplying plants as human food
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!