Answer:
iris - b
cornea - f
lens - e
retina - c
photoceptors - b
optic nerve - h ( definately know dis one)
rod cells - e
pupil - a
cone cells -g
i tried
Explanation:
Answer:
Option (B).
Explanation:
Liver is an important organ that regulates the metabolic pathway of the body and helps in the process of digestion. The improper functioning of liver can cause yellowish skin, edema and high blood pressure.
Mrs F medical condition clearly describes the improper functioning of liver. The liver helps in the formation of bile juice. Bile is a soapy compound that helps in the emulsification of lipids.
Thus, the correct answer is option (B).
False, because most organisms decompose fairly quickly after they die. For an organism to be fossilized, the remains usually need to be covered by sediment soon after death. hope this helps :))
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
