1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alborosie
3 years ago
7

Describe the main difference between weather and climate.

Biology
1 answer:
svetlana [45]3 years ago
3 0

Answer: Easy my friend Whereas weather refers to short-term changes in the atmosphere, climate describes what the weather is like over a long period of time in a specific area. Different regions can have different climates. ... Weather tells you what to wear each day.

Explanation:

You might be interested in
Can someone answer this please?
gulaghasi [49]

Answer:

"Fat cell, yellow bone marrow, femur, nervous system."

Explanation:

Via process of elimination, we can eliminate the first and last answers, as the biggest unit of a single organ system would be the entirety of the system, and those have the system itself jumbled in between the list.

That leaves us with the center-two answers. I believe "bone" is too vague, meaning that bone, in some cases, may be smaller than cartilage, thus, leaving you with the above answer.

5 0
3 years ago
Read 2 more answers
All life depends on the availability of usable energy. This energy is released when
kiruha [24]

Answer:

3 (Cells carry out the respiration process)

Explanation:

Cellular respiration is a metabolic (catabolic) process common to all living things as all living things need energy for their life processes.

Respiration is the biochemical process in which the cells of an organism obtain energy by breaking down organic molecules in presence or absence of oxygen (aerobic or anaerobic) resulting in the release of Carbondioxide (CO2), water and Adenosine triphosphate (ATP).

Food molecules (containing stored energy in their chemical bonds) absorbed after digestion are broken down and the energy within their molecules are freed. This freed energy in form of ATP, is used to power the organism's movement and physiological functions.

Note that, ATP is an energy carrying molecule and a usable form of energy by cells. This is so because ATP releases energy quickly. Energy is released from ATP when the end phosphate (Pi) is removed to become ADP (adenosine diphosphate), which is a low energy molecule.

Aerobic cellular respiration consists of Glycolysis, Kreb's cycle and Oxidative phosphorylation. A total of 38 ATP molecules is produced in the cytosol of prokaryotes while a total of 36 ATP molecules is produced in the mitochondria of eukaryotic cells.

8 0
3 years ago
Dinobryon is a species of protozoa that reproduces asexually. How is it better for the survival of the species for the protozoa
MakcuM [25]

Answer:

A. They do not use up any energy finding mates.

Explanation:

The asexual reproduction consists of one parent which are same to each other while on the other hand consists of two parent that produced unique.

For species survival, the reproduction of protozoa asexually rather than sexually could be better when they don't use much time and energy for determining the mates

Therefore in the given case the correct option is A.

4 0
3 years ago
Darwin explained that all life came from ________________
AnnZ [28]

Answer:

one common ancestor

Explanation:

Although Darwin’s theory is often described as the theory of evolution by natural selection, most commentators recognize that common ancestry (the idea that all organisms now alive on earth and all present day fossils trace back to one or a few “original progenitors”) is an important part of the Darwinian picture.

3 0
3 years ago
Vitamin d _____.
svetlana [45]
Vitamin D plays a vital role in the regulation of calcium deposits and maintenance of the phosphorous levels in the blood which are two elements that are significantly important for maintaining healthy bones.

The human body needs vitamin D to absorb calcium in the intestines and to recover calcium that would otherwise be excreted through the kidneys. It also essential for the development and strengthening of bones and it blocks the release of parathyroid hormones.

The answer would be letter E. None of the above
5 0
3 years ago
Other questions:
  • What is occurring in the endocrine system during a "fight or flight" response?
    12·2 answers
  • The field of science that investigates the relationships between the nervous system and behavior/mental processes is ____.
    10·1 answer
  • Which type of reproduction involves both parents?
    9·2 answers
  • Why do saturated fatty acids have straight structures, while unsaturated fatty acids have bent structures?
    8·2 answers
  • Which of the following statements is true about solar eclipses? There is a solar eclipse every month. All solar eclipses are tot
    6·1 answer
  • The correct sequential path of a normal action potential in the heart is:
    6·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • NEED FAST
    5·1 answer
  • Which of the following is NOT a source of genetic variation in a population ?
    14·2 answers
  • What are constituents of chromosome?​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!