during an experiment you make observations to test the hypothesis and prediction
Friction and earth quakes
Answer:
Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
TTAAGCGGCCATAATCTGCAA
Explanation:
Answer:
is always a higher organism
Explanation:
lets take an example:
food chain consisting of zooplankton, small fish, big fish and man
as the order goes in the question ,the organism at the end of this food chain is man
The right answer for the question that is being asked and shown above is that: "b. the act<span>ual yield may be different from the theoretical yield because reactions do no always go to completion." This is the statement that is not true about "yield."
</span>
