1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maxonik [38]
4 years ago
7

What event must happen before a cell can enter into cellular division?

Biology
1 answer:
kondor19780726 [428]4 years ago
5 0
It has to complete the interphase and then it starts cell division when it enters the mitosis stage.
You might be interested in
The San Andreas fault lies along the boundary of the: North American and Pacific plates South American and Pacific plates North
Scilla [17]

Answer:

Ok, I don't know if this will help any, but it is in the Gulf of California.

Explanation:

I'm pretty sure that those are the North American and Pacific plates?

3 0
3 years ago
Read 2 more answers
The human population has experienced exponential growth Sustainability is crucial. Describe what this means in terms of natural
Masja [62]
We might run out 4&7.):‘dogs dkxubdnfkcjd
6 0
3 years ago
Are all of the cells flashing green the same way? if not, what might explain any variation observed. Give two possibilities.
borishaifa [10]

Cells do not blink in the same way because the amount of proteins between cells is unequal and the stage of each protein can be different between cells.

<h3>What is a protein?</h3>
  • They are molecules present in living beings.
  • They are essential molecules for the maintenance of the organism.
  • They are macromolecules made up of amino acids.

Proteins are subject to the emission of green light when certain products are applied to cells. However, even similar cells from the same organism will not emit this light equally due to the difference between the amount and stages of the protein in each cell.

More information about proteins at the link:

brainly.com/question/2193769

6 0
3 years ago
A Kit Kat bar contains layers, which represent _____________________ in a clastic sedimentary rock
nignag [31]

Answer:

Foliation

Explanation:

I just searched it. Foliation is layering in rocks, just like kit kats are layered.

8 0
3 years ago
What is the structural support of a jellyfish?
Cerrena [4.2K]
<span>The composite mesoglea of jellyfish and sea anemones provides structural support using collagen fibers in a complex gel matrix.</span>
5 0
4 years ago
Other questions:
  • Assume that Staphylococcus aureus grows on nutrient agar with up to and including 15% (w/v) NaCl, while Escherichia coli cannot
    5·1 answer
  • A tetraploid organism has four copies of each chromosome in a single cell. how many copies of each chromosome end up in a gamete
    14·1 answer
  • Which is a correct guideline of science?
    12·2 answers
  • A person could float most easily in water that has which characteristic?
    12·1 answer
  • Which of the following statements BEST describes the importance of carbon in the cell
    11·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • True or False: DNA is always turned on all the time in all of your cells.
    12·1 answer
  • Genetic evidence supports the idea that all organisms are related. This is because:
    10·1 answer
  • What type of data is one of several groups or forms?
    5·1 answer
  • What are induced pluripotent stem cells and how
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!