1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex17521 [72]
3 years ago
13

I need help!!! Please

Biology
1 answer:
azamat3 years ago
7 0
You should use socratic !!
You might be interested in
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
Why are the beak sizes and shapes of Darwin’s finches different?
maria [59]

Answer:

Adaptation

Explanation:

Some beaks made it easier for the type of food that bird was trying to get, for example the sharper the beak the better it could possible break a nut

6 0
3 years ago
Read 2 more answers
Haploid spores are produced in what of a moss​
Amanda [17]

Answer:

sporangium! :)

7 0
3 years ago
Read 2 more answers
The cell membrane controls movement of materials into and out of the cell. The following particles are moving from high concentr
Rashid [163]

Answer:

B. active transport

Explanation:

8 0
3 years ago
Read 2 more answers
Why is it important to study grouse habitat selection and demography relative to human land use practices?
nadya68 [22]
Grouse species have evolved living in environments with little vertical structure and in areas with minimum human activity (from roads and cultivation to other more complex infrastructure). In the recent decades, there has been a significant increase in wind energy development in diverse areas and ecosystems. This development involves construction and placement of tall man-made structures, such as wind turbines and other infrastructure in habitats with high wind capacity. These habitats are often occupied by grouse species. This coexistence could severely endanger the species survivorship and reproductive ability. It is very important to study grouse habitat selection and demography, so that appropriate regulatory guidelines can be applied to wind energy development.
6 0
3 years ago
Other questions:
  • What are two ways does a deer depends on a plant
    7·2 answers
  • ¿que organismo o institución en el Perú se encarga de estudiar el clima para realizar los perfiles climáticos?
    8·1 answer
  • When you are exposed to disease causing germs which type of tissue is your first line of defense
    10·1 answer
  • Using an example (from class or another) and one of the forms of evolution, explain in a short paragraph the true scientific mea
    13·1 answer
  • The vocal cords are two bands of tissue that extend across the opening of the: larynx glottis trachea epiglottis
    5·1 answer
  • What is a sentence using Active Transport?
    11·2 answers
  • Anybody can help me out?
    14·1 answer
  • Culturing of the sputum resulted in the growth of distinct colonies on the medium, and the technician informs you that further i
    7·1 answer
  • Glycogen synthase is an enzyme important for making glycogen. In response to glucagon, glycogen synthase is Glycogen synthase is
    13·1 answer
  • What is the photosynthesis formula written in letters? <br><br> Helpp
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!