The generation of electricity through nuclear energy reduces the amount of energy generated from fossil fuels. Less use of fossil fuels means lowering greenhouse gas emissions and others.
Answer:
I haven't really learned about cell types but I did find this information
Explanation:
How can epinephrine have different effects on different cells? Different cells have different receptors that bind epinephrine. Different cells activate different enzymes as a result of epinephrine binding.
epinephrine induces increased vascular smooth muscle contraction, pupillary dilator muscle contraction, and intestinal sphincter muscle contraction. Other significant effects include increased heart rate, myocardial contractility, and renin release
Hope it at least helps a little :)
Answer: Asexual
Explanation: Since only one parent is needed, asexual reproduction is more beneficial. It is a "simpler" (in terms of not needing two mates to fornicate) and causes species to reproduce at a faster rate
Your answer would be C i believe
the cholera outbreak was a pandemic because it spread through 3 continents
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
