1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlad1618 [11]
2 years ago
12

What atmosphere is the sun located? Troposphere, Mesosphere, Stratosphere?

Biology
2 answers:
iris [78.8K]2 years ago
8 0
Photosphere,chromosphere and the corona
GrogVix [38]2 years ago
7 0
The atmosphere of the sun is composed of several layers mostly the photosphere the chromosphere and the coroner

.
You might be interested in
Compare a cell that has grown too large to be efficient with a wireless network that has too many users explain how both have th
Natasha_Volkova [10]
The have similar problems because since the cell has grown too large, it takes away nutrients that other cells need to survive. This is similar to too many users on a wireless network because with too many users, their is not enough network to supply each device on the wireless network.
4 0
3 years ago
Read 2 more answers
Which products result from carbohydrate metabolism?
a_sh-v [17]

Answer:

pyruvate and acetyl-CoA

Explanation:

The first step of respiration reactions is glycolysis. When glucose is broken down in glycolysis, the first molecule that is produced is pyruvate. If pyruvate continue to aerobic respiration, it must enter the matrix of mitochondria and be oxidised to Acetly Co-A.

6 0
3 years ago
You should carry the microscope with the base in the palm of one hand and the other hand on the arm.
Sergeu [11.5K]
The answer is

A. True
3 0
3 years ago
Which two hormones influence the endometrium to thicken and prepare for implantation?.
dangina [55]
Progesterone and oestrogen
4 0
1 year ago
Materials that allow some of the light to pass through and the rest of the light to be scattered are called __________.
Nikitich [7]

Answer:

translucent

Explanation:

opaque surfaces allow no light to pass through, transparent surfaces allow all light to pass through and reflective surfaces reflect light.

5 0
3 years ago
Other questions:
  • How are a coconut seed and a watermelon seed most alike?
    10·1 answer
  • Ba-17 why are low head dams dangerous to small boats and paddle craft
    14·2 answers
  • How would the coils in the middle of the diagram change
    8·1 answer
  • Vineyards and orchards operate all year round. What are some practices from the recommended list of physical/cultural control th
    14·1 answer
  • A client has discussed therapy for his hiv-positive status. what does the nurse understand is the goal of antiretroviral therapy
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • WILL GIVE BRAINIEST IF THEY GIVE A CORRECT ANSWER!!! 50 POINTS!!!!<br> what eats sunbeam snakes?
    9·2 answers
  • Is photoshynthesis a chemical change ? yes or no ?
    13·1 answer
  • How is the phloem in a leaf related to the roots of the plant?
    7·1 answer
  • How can biotechnology be used to develop medical treatments and give an example?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!