1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yarga [219]
2 years ago
5

Which label belongs in the area marked "Y"? may change the type of amino acid decreases the number of bases in the sequence neve

r changes the type of amino acid increases the number of bases in the sequence
Biology
2 answers:
Marat540 [252]2 years ago
7 0

Answer:

decreases the number of bases in the sequence

Explanation:

:)

storchak [24]2 years ago
5 0

Answer:

The answer is "decreases the number of bases in the sequence".

Explanation:

Please find the complete question in the attached file.

The deletion mutation has been the retraction of a gene encoding base which alters the read-frame with codon it beyond mutation point. Its mutation or replacement includes the substitution of a framework with another base, throughout this situation the diagram describes the number of bases in the sequence belonging to the "X" marked area as the comparison of deletion and replacement mutations.

You might be interested in
State at least four (4) types of<br> biological association.​
maw [93]

Answer:

mutualism - a mutually beneficial symbiotic relationship.

commensalism - a one-sided symbiotic relationship.

parasitism - one species lives on, in or with a host species.

competition - relationship in which organisms compete for resources.

Explanation:

3 0
2 years ago
Where most dna is found in a eukaryotic cell. Sun clue
Nataly [62]
Nucleus,mitochondria and cytoplasts
3 0
3 years ago
The algae at the beginning of the food chain is a_______.
podryga [215]

Answer:

c

Explanation:

yep

4 0
2 years ago
Read 2 more answers
How do pioneer species make ecological succession possible on an island formed from a volcanic eruptions
SIZIF [17.4K]

Answer:

The correct option is <em>3. they break down rock into soil in which plants can grow</em>

Explanation:

When a disaster is such huge that even the soil and organic matter get removed from the place, then the succession that will occur in such kind of place will be termed as primary succession. For example, a volcanic eruption or an earthquake.

On the other hand, if after a disaster some of the organic matter remains on the land, then the succession that will occur will be termed as secondary succession. E.g a succession after fire

In primary succession, the pioneer species will be plants that require less soil such as the lichens. The lichens will break down the rocks into the soil and eventually new species of plants will start to grow on the land.

3 0
3 years ago
What makes the structure of Carbon so unique? Why is Carbon considered the building block of all life? (3 sentence minimum answe
svetoff [14.1K]

Answer:

The carbon atom has unique properties that allow it to form covalent bonds to as many as four different atoms, making this versatile element ideal to serve as the basic structural component, or “backbone,” of the macromolecules.

All living things contain carbon in some form. Carbon is the primary component of macromolecules, including proteins, lipids, nucleic acids, and carbohydrates. Carbon's molecular structure allows it to bond in many different ways and with many different elements.

Explanation:

5 0
2 years ago
Other questions:
  • Water near the poles is most likely to be stored as a ?
    13·1 answer
  • What statement is true about lipids
    11·1 answer
  • What are the possible ways that a mutation may affect an organism
    10·2 answers
  • to support life,why must a planet have a roughly circular orbit around a sd tar?A.so fresh water is available.B.to keep the prop
    13·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Enzymes speed up chemical reactions. Which statement correctly identifies the function of the enzymes involved in DNA replicatio
    15·1 answer
  • What is the role of tRNA synthetase in the cell's cytoplasm?
    10·1 answer
  • Which structure of a protein is the arrangement of polypeptides?
    13·2 answers
  • Where do the products of photosynthesis come from? a. we exhale them b. plants c. we inhale them d. animals e. a chemical reacti
    7·1 answer
  • Describe the possible effect of a thick cuticle layer in drought conditions.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!