1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ANTONII [103]
3 years ago
5

Components grouped together for a particular function form a _____ system. natural non-living living

Biology
1 answer:
BigorU [14]3 years ago
4 0
Natural system is former when various components get grouped together for a particular function
You might be interested in
Proteins are used to enable movement, provide structure and support and carry out important chemical reactions inside the body.
guajiro [1.7K]

Answer:a diet rich in amino acids

Explanation:

8 0
3 years ago
How do they all function together?__________________________________________
allsm [11]

Answer:

Como funcionam todos juntos? __________________________________________

Explanation:

espero ter ajudado boa noite

7 0
3 years ago
Nervous tissue contains specialized cells called
Olin [163]
Their called Neurons
7 0
3 years ago
called CF is a condition that causes excess mucus production in the lungs and if untreated causes early death. CF is caused by a
lana66690 [7]

Answer:

The correct answer is - by absorbing too much sodium and water into the cells in the respiratory system.

Explanation:

Cystic fibrosis or CF is a genetic disorder that is caused by the presence of two defective genes that leads to the production of thick and sticky mucus in an individual that affects the respiratory and digestive system by clogging mucus in it.

Due to defective genes, there is an abnormal electrolyte transport system develops in which cells of the respiratory system including the lungs absorb an excessive amount of salt (sodium) and water. It all caused by deletion of the three letters which means an amino acid from a gene that leads to the disruption of the protein that controls the production of the mucus and abnormal electrolyte transport.

4 0
3 years ago
Mangrove forests were traditionally viewed as _______. a. unproductive wastelands b. valuable fish habitats c. an erosion preven
Firdavs [7]
Mangrove forests were traditionally viewed as A. unproductive wastelands. People therefore reasoned that their removal would improve the health of their ecosystems, leading to their degradation. 
3 0
3 years ago
Read 2 more answers
Other questions:
  • You need to measure three things: 1. a quantity of water 2. the length of a leaf 3. the mass of a small stone Which unit of metr
    7·1 answer
  • If you were interested in improving the soil structure in your garden, what could you add?
    13·1 answer
  • How would signaling be affected if a mutation caused a g protein to replace gdp with gtp on its own without needing to be activa
    15·1 answer
  • Suppose the quantity of nursing services demanded exceeds the quantity of nursing services supplied. The nursing wage rate will:
    8·1 answer
  • What do different environments cause different species to do?
    10·2 answers
  • Answer the following questions:
    9·1 answer
  • Suggest a reason that so many marine organism spend their segment of their life cycle as plankton.​
    14·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Hurry im giving 50 point
    9·2 answers
  • Give one similarity between the cell theory and the theory of spontaneous generation.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!