1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goblinko [34]
3 years ago
9

Describe each of the four mechanisms that cause air to rise.

Biology
1 answer:
BARSIC [14]3 years ago
3 0
The four mechanisms are as follows:
1) Orographic lifting: Air is forced to rise over a mountainous barrier
<span>
2) Frontal wedging: Warmer, less dense air is forced over cooler, denser air along a front 
</span>
<span>3) Convergence: Pileup of horizontal air flow resulting in an upward flow
 </span>
<span>4) Localized convective lifting: Unequal surface heating causes localized pockets of air to rise because of their buoyancy. </span><span />
You might be interested in
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
in an experimental investigation the group that is not manipulated by the researcher and is then compared to the experimental gr
trasher [3.6K]
I think it is the Control Group 
7 0
3 years ago
Read 2 more answers
What are the 8 cranial bones?
Arada [10]
<span>1 x Ethmoid Bone
1 x Frontal Bone
1 x Occipital Bone
2 x Parietal Bones
1 x Sphenoid Bone
2 x Temporal Bones
:)

</span>
6 0
3 years ago
Read 2 more answers
Explain how buming fossil fuels can lead to a lower ocean pH
NISA [10]

Answer:

By letting the fossil die in the sea in let sit for a long time

Explanation:

7 0
3 years ago
In a hypothetical breed of dogs, coat color is controlled by two genes. There are six different coat colors in this breed: black
Andru [333]

The correct statements are C and F.  

There are two elementary types of pigments, which are responsible for the color of the coat, that is, phaeomelanin and eumelanin. Eumelanin is basically a black pigment and cells produced by it are responsible for a black dog coat color. However, there are genes that result in changes in eumelanin to produce brown, gray, or dusty pale brown coat color. The genes responsible for this change leads to the modifications in the creation of the eumelanin in the cells.  

Due to this reason, dusty pale brown and gray dogs are considered as dilutes. Eumelanin can also be witnessed in eyes and nose. On the basis of the genes in dogs, the nose can be brown, black, dusty pale brown, or gray. The other pigments, that is, phaeomelanin is red. Most of the dogs exhibit both phaeomelanin and eumelanin, and the manner in which these two pigments get amalgamated is controlled by agouti locus.  

The white color in dogs is not stimulated by any pigment, but by the cells that do not possess the capability to produce any kind of pigment. The entire animal can be affected in a different manner to albinos, or it can be restricted like the white coat patterns.  

The correct statements regarding the mode of inheritance of the coat color genes are:  

1) One of the genes modifies the expression of the other.  

2) One of the genes is autosomal, and the other is X-linked.  

8 0
3 years ago
Other questions:
  • Which type of fossil can help us understand an organism's activity during its lifetime?
    8·2 answers
  • “When the atoms of a specific substance are regrouped, a new substance is formed with often vastly different properties from the
    12·1 answer
  • Molecules that are too large to be moved through the cell membrane can be transported into the cell by
    15·2 answers
  • • Human body is composed of
    12·2 answers
  • Plants alternate their generations by switching between
    10·1 answer
  • Decomposers are important in the environment because they
    5·1 answer
  • Tha main mineral component of lime is "blank" carbonate​
    14·2 answers
  • What plant tissue does water travel through?
    15·1 answer
  • Important question of science for class 8 .. help me assap ​
    8·1 answer
  • Which is an example of active transport
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!