1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ycow [4]
3 years ago
14

If someone extracted your DNA should they be able to use it without your consent

Biology
1 answer:
White raven [17]3 years ago
4 0
No because they would be ignorant if they didn't ask you first
You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
The two naming system developed by Linnaeus is called
xenn [34]

Answer:

Binomial Nomenclature.

Explanation:

This method gives species a new name that consists of two latin names put together. The two latin names put together must be the species name and genus name.

4 0
2 years ago
What planet is planet A?
Andrej [43]

Venus is the answer, you can tell easily because Venus has no moons or rings :)

3 0
3 years ago
Read 2 more answers
A population of Purple Gorillas feeds entirely on plants. But some of these Gorillas are good at digesting Plant A, while others
Ray Of Light [21]
The species has a higher chance of survival as there are 3 plant types, even if 2 of those die out, there's a portion of the purple gorillas that can still eat the remaining plant type
7 0
3 years ago
The pKa of an acid depends partly on its environment. Predict the effect of each of the following environmental changes on the p
Galina-37 [17]
The pKa represents the pH of the medium at which the zwitterionic amino acid assumes most stable ionic form due to structural stabilization. As the pKa is dependent upon the environmental factors of the solution around the amino acids, a change in their structure and localization can cause change in the pKa of the protein. Thus, the answers can be found as below:

Part A: Decrease (As the lysine is basic in nature, it will tend to stabilize the electrostatic interaction and weak interactions between the acidic amino acids and hydrogen bonds in the viscinity, thus lowering the pH and hence pKa of the protein)

Part B: Increase (As the carboxyl group is acidic in nature, removal of it will tend to increase the pKa since the basic amino acids will tend to accumulate more negative charge in their viscinity)

Part C: Increase (As glutamic acid is an acidic amino acid, its shift from outside to a non-polar site will prevents its ionization and hence the pKa will tend to shift from slightly acidic to slightly basic, hence increase)
3 0
3 years ago
Other questions:
  • A car panel lamp has a resistance of 33 ohms when it is placed across a 12 V battery. What is the current through the circuit?
    12·2 answers
  • Why are nutrients needed for living things? Describe the difference between living and nonliving things.
    9·2 answers
  • biology: If one honeybee makes 1/12 teaspoon of honey during its lifetime, how many honeybees are needed to make 1/2 teaspoon of
    5·2 answers
  • Paraphrase four safety practices you should always use when you begin scientific inquiry
    7·1 answer
  • Water is a polar molecule because one area is ________________ and another area is ______________________.
    10·1 answer
  • CORRECT ANSWERS ONLY, IF YOU SEND ME A LINK TO A SITE YOU WILL BE REPORTED.
    14·1 answer
  • 14. In canaries, the singing gene (S) is dominant over nonsinging (s). When a 1 poin
    7·2 answers
  • What characteristic of life can you live without out of the 10 main ones
    6·1 answer
  • Where does pyruvate oxidation occur in eukaryotic cells
    14·2 answers
  • How do energy and matter move in ecosystems?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!