1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
weqwewe [10]
3 years ago
7

entify the plant phylum based on the description. A tree that can be found in the mountains and produces seeds in cones is a typ

e of . A tree that produces blossoms that can be fertilized and develop into fruit is a type of . This low-lying plant that requires damp surfaces and does not have a system to transport water is a .
Biology
2 answers:
Harrizon [31]3 years ago
4 0

Answer:

1. Coniferophyta

2. Angiospermae

3. Bryophyta

Explanation:

1. Coniferophyta

The Phylum Coniferophyta is characterized by trees that grow in high altitudes, belonging to forest ecosystems that are found in the mountains. Coniferophytes, the trees from this phylum, produce ovules that mature into seeds that will be located in structures known as cones.

  • For example, <em>Pinus virginiana</em> - Scrub Pine.

2. Angiospermae

Angiosperms are also known as flowering plants that produce seeds contained inside a fruit. More than half of the trees we found in nature are angiosperms or flowering plants.

  • For example, <em>Malus domestica</em> - Apple tree.

3. Bryophyta

Bryophytes, also known as land plants, are non-vascular plants that reproduce via spores instead of seeds like angiosperms or coniferophytes. Therefore, they need to live in humid habitats and do not possess a system that transports water.

  • For example, <em>Leucobryum glaucum</em> - Pincushion moss.
frosja888 [35]3 years ago
4 0

1. Coniferophyta

2. Angiospermae

3. Bryophyta

You might be interested in
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
MATCH THE DEFINATION!
Sonbull [250]

Answer                           The definitions are matched according to the terminology given below.   Ribosome                                This organelle is the site of polypeptide assembly. This two part organelle is found in endoplasmic reticulum.   Lysosome                       The cellular digestion and disposal of biological molecules occur inside this organelle.    Mitochondrion                         Aerobic respiration occur in this organelle.   Endoplasmic reticulum                             This generally play role in cell defence.            

3 0
3 years ago
To collect quantitative data, scientists use all of the following except _____.
kolezko [41]

Answer:

a stop watch

Explanation:

what would you be doing with a stop watch for collect quantitative data

4 0
3 years ago
Read 2 more answers
Match the phase of mitosis with the event listed: 1. The genetic material is duplicated interphase 2. Chromosomes move to opposi
damaskus [11]

ANSWER: the genetic material is duplicated interphase.

The process by which a cell which has previously replicated chromosomes in the nucleus of the cell is separated into  two identical sets of chromosomes is known as mitosis. Mitosis is the division of the mother cell into two daughter cells,  these daughter cells are genetically identical to each other and to the parent cell. It is  a form of nuclear division.  Mitosis is generally followed by cytokinesis, this process divides the nuclei, cytoplasm, cellular organelles and cell membrane  into two cells of roughly equal shares of these cellular constituents. The M phase of the cell cycle is of mitosis and cytokinesis together. Cell division is a process with sequence of steps that enables organisms to grow and reproduce.  Genetic material is replicated in parent cells and is distributed equally to the two daughter cells.  Cells undergo a period of growth called interpahse before entering mitosis. During the interphase,  the genetic material replicates and the organelles prepare for division. In the process of mitosis,  the parent's cell genome is transferred into the two daughter cells. The daughter cells are similar to each other and to their parent cell.

The cell's genome is composed of chromosomes that are complexes of tightly coiled DNA that contain the genetic material which  is vital for the proper functioning of the cell.  

The process of mitosis begins when the chromosomes condense. In most eukaryotic cells,  the nuclear membrane segregates the DNA from the cytoplasm into membrane vesicles.  The ribosomes also dissolve, the chromosomes align themselves. Microtubules pull apart the sister chromatids of each chromosome.  The daughter chromosomes are pulled towards opposite ends. Nuclear membrane forms around the separate daughter chromosomes.  In animal cells, the area of cell membrane pinches inwards, to form the two daughter cells, the imaginary line is called the cleavage  furrow which separates the developing nuclei. In plant cells, the new dividing cell wall is constructed in between the daughter cells.  The parent cell will thus split in half and give rise to two daughter cells.

7 0
4 years ago
the nuclei of most atoms contain multiple protons. each proton has a positive charge. if objects that have like charges repel ea
Marrrta [24]
The answer is <span> a strong nuclear force between an atom’s protons and neutrons holds together the atom’s nucleus. 

Electromagnetic forces are the cause why like charges repel and vice versa, why unlike charges attract. For an atom's protons to hold together and not to fly apart, there must be a force that is stronger than the electromagnetic force. Therefore, the </span><span>strong nuclear force between an atom’s protons and neutrons holds together the atom’s nucleus. </span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • I have a test about metabolism can someone please explain the subject well? Like just give me a explanation of how it works, and
    13·2 answers
  • Ecosystem services ________. contribute to keeping ecosystems productive are actions humans must take in order to protect and se
    9·1 answer
  • Embryonic similarities persist for longer between organisms<br> that have a closer common ancestor.
    8·1 answer
  • Which structure in the figure below is commonly injured by people inserting cotton swads or other objects into their ears?
    9·2 answers
  • In your biology lab, The distinguishing animal trait "A," that separates the body forms of the eumetazoa and then parazoa use a
    11·1 answer
  • True or false fossils can show evolutionary relationships between organisms?
    13·1 answer
  • John, a 19 year old boy, wanted to figure out why he wasn't sleeping well at night. He normally and heads to bed by 11 pm and wa
    10·1 answer
  • In what form is the DNA found when a cell is beginning cell division or is involved in cell division?
    6·1 answer
  • Students observed a plant left by a window over several days. The plant was watered daily. After three days, the plant began to
    7·1 answer
  • A . Choose the correct option.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!