1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bad White [126]
3 years ago
14

(x2 − 8x + 5) − (−3x2 + 5x − 9)

Geography
1 answer:
Lady bird [3.3K]3 years ago
6 0
4x^2-13x+14 hope this helps
You might be interested in
What are the 3 types of waves that an earthquake produces
belka [17]

Earthquakes produce three types of seismic waves: primary waves, secondary waves, and surface waves. Each type moves through materials differently. In addition, the waves can reflect, or bounce, off boundaries between different layers.

7 0
3 years ago
How many people live in the urban center of Buenos Aires, Argentina? How do economic activity and climate help explain why so ma
Levart [38]

Answer:

2.89 Million People

Explanation:

Most of Argentina is mountainous (The Western side), which has extreme cold temperatures which makes it a popular skiing destination for tourists, it also happens to be not as populated. However, what makes Buenos Aires so different is that it's along the ocean, which makes it a much more livable and sustainable climate, it also gets a large economic boost because it has a large docking and trade system located there.

Examples of this would be other lightly populated rough climate countries such as Mongolia, which has only a population of 3 million despite it's large land borders.

5 0
3 years ago
-Lack of food and drinking water for wild animals
sergeinik [125]
I think it is a drought but i dont know
3 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Give me moeny please
egoroff_w [7]

Answer:

same give me money too.......please

6 0
3 years ago
Read 2 more answers
Other questions:
  • What historical event in medieval history led to European interest in trade with the Middle East?
    13·1 answer
  • Identify the statement that is true about mass extinctions.
    6·2 answers
  • Where do tectonic activities, such as earthquakes,bored volcanic eruption, tend to occur?
    7·1 answer
  • Which phrase best defines erosion?
    14·2 answers
  • What are some of the factors that can cause a country‘s gross domestic product per person to change
    5·1 answer
  • What's the only place in this world whos Fahrenheit and Celsius degrees can be equal?
    9·2 answers
  • Island whose eastern half is a sovereign state
    7·1 answer
  • How do we define time globally?
    14·1 answer
  • What is the boundary line for the Southern Ocean?
    8·2 answers
  • this planet is comprised mostly of iron and nickel and is one of the densest planets in our solar system.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!