1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
padilas [110]
3 years ago
15

Name the appendages found on the head of a crayfish and tell the function of each crayfish

Biology
1 answer:
mote1985 [20]3 years ago
3 0
The head<span> (or cephalic) region has five pairs of </span>appendages<span>. The antennules are organs of balance, touch, and taste. Long antennae are organs for touch, taste, and smell. The mandibles, or jaws, crush food by moving from side to side.</span>
You might be interested in
mosquitos have 6 chromosomes, dogs have 78, and a adder's tongue fern has 1262 chromosomes. Given this information, what can be
kherson [118]

Answer:

No information can be inferred

Explanation:

Chromosome number provides no reference for establishing any relationship between organisms. The number of chromosome cannot depict whether a living species belong to plant kingdom or animal kingdom. It cannot even depict the evolutionary history of any species. Thus, the organism with lesser chromosome has not necessarily evolved from the species having larger number of chromosome or vice versa.  

Chromosome number can only depict the quantity of genetic material with in an organism and hence no relationship can be established living species only on the basis of chromosome number.  

7 0
3 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Which is the best evidence to prove that irene was heterozygous for hemophilia
love history [14]

A. Alice carried the recessive allele


4 0
3 years ago
In what ways does one biotic factor interact with the abiotic factors????
babymother [125]

Answer:

Soil getting dug up by moles.

6 0
3 years ago
Energy from sunlight is _____; if it is harnessed to move a turbine and generate electricity, then it has been converted to ____
kogti [31]
It is A
Since radiant energy is energy that travels through waves, <span>particularly electromagnetic radiation (</span>heat or x-rays)<span>, then it has to be radiant energy. Mechanical energy is used to move objects such as that of a turbine.</span>
7 0
3 years ago
Other questions:
  • Which state of matter is made up of particles that can only vibrate back and forth?
    9·1 answer
  • The sabin vaccine was a liquid that contained weakened polio viruses. those who have received this vaccine are protected against
    9·2 answers
  • (04.03 HC) Salvatore had grown tired of his fish tank and would like to get rid of the fish and contents of the tank in a nearby
    15·2 answers
  • What is the image taken from the electron microscope shown in this figure ??​
    14·2 answers
  • Which of the following describes a rapidly expanding population?
    10·2 answers
  • Why is the breakdown of glucose from photosynthesis important?
    5·1 answer
  • 1.
    10·1 answer
  • In a plant where does the matter come from
    7·1 answer
  • Organismo unicelular y procariota​
    15·1 answer
  • The immediate source of the intracellular fluid surrounding all human body cells is:_____.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!