1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AysviL [449]
3 years ago
9

Where is DNA replication located

Biology
1 answer:
Step2247 [10]3 years ago
6 0
In the nucleus. Hope this helps
You might be interested in
Which theory suggests that cells are the basic building blocks of life but don't constitute life itself? cell theory organismal
krok68 [10]
Organismal Theory.

The answer is not Cell Theory because cell theory constitutes to life itself where the organismal theory does not.

Hope this helps!
7 0
3 years ago
Read 2 more answers
The movement of solute molecules from an area of high concentration to an area of low concentration that does not require energy
muminat
The answer to your question is Passive Transport.
3 0
3 years ago
The temperature on a distant planet is measured to be 183 Kelvin by a space probe. This temperature converts to ______ degrees C
vovangra [49]
-90.15......................... (dots for the 20 words thing)
4 0
3 years ago
Over the last several decades, the scientific community has gathered a large amount of information regarding genetics and geneti
emmasim [6.3K]
I think the correct answers from the choices listed above are options B and C. The two main sources  that lead to increased genetic variation would be Gamete mutations and recombination. <span>Gametes mutations leads to change in DNA information, recombination allows mixture of genotypes.</span>
8 0
3 years ago
Read 2 more answers
Explain why John converted change in mass to percentage change in mass.
EleoNora [17]

Answer:

Explanation:

The difference in mass does not deal with the proportional aspect of the solutions, making the results less accurate. The percent was calculated to give an exact difference, along with considering the quantities of solution.

mark me a brainliest

5 0
3 years ago
Read 2 more answers
Other questions:
  • What kind of quantity is a force?
    8·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which bone does not form part of the lateral or superior walls of the nasal cavity?
    7·1 answer
  • Que le falta a Puerto Rico para ser un pais sustentable?
    10·1 answer
  • Find 4 digit code escape room
    12·1 answer
  • What should I do when my family makes fun of me because i have Entomophobia (fear of any insect) everytime i go outside and see
    8·2 answers
  • How would our lives be different if water could not dissolve most substances?
    13·1 answer
  • Which substance in green plants needs to absorb sunlight during photosynthesis?
    15·1 answer
  • Enter the correct 4 digit code (no spaces) *<br><br> This is a required question
    6·1 answer
  • CAN YOU PLEASE HELP ME(GIVING BRAINLIEST) NEED TO GET QUISTION CORECT FOR GOOD GRADE
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!