1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blagie [28]
3 years ago
9

If a tRNA molecule has an anticodon which reads AUG, what will it match up with and what amino acid is it carrying?

Biology
2 answers:
mariarad [96]3 years ago
7 0
The best and most correct answer among the choices provided by your question is the first choice or letter A.

<span>It is carrying arginine and will match with a CGU codon on the mRNA.</span>

I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!
Anastaziya [24]3 years ago
3 0

no, it's not a. it's d) It is carrying tyrosine and will match with a UAC codon on the mRNA

if the tRNA is AUG, then the mRNA would be UAC.

<em>U goes with A</em>

<em>A goes with U</em>

<em>T goes with A</em>

<em>G goes with C</em>

<em>C goes with G</em>


to find out how which amino acid is it you can use the chart below, which should be tyrosine. :)

You might be interested in
List three ways patients will benefit from pharmacogenomics.
garri49 [273]

Answer:

By reversing that trend, pharmacogenomics helps to refine the focus of treatment and makes drugs more effective and less toxic. ... Thus, many potential drugs which may be lost due to the effects on the outliers in a study can be retained when pharmacogenomic study is used in the future.

Explanation:

4 0
3 years ago
3. Organisms that belong to the same class must belong to the same: (check)
Colt1911 [192]

Answer:

The taxonomical classification of organisms follows this list of categories

Kingdom

Phylum

Class

Order

Family

Genus

Species

The number of organisms decrease from the top(Kingdom)to the bottom(Species).

Order Phylum is the answer

7 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Most fat-soluble nutrients are absorbed in the _______ system. Question 19 options: vascular lymphatic neurological adrenal
Leya [2.2K]

Most fat-soluble nutrients are absorbed in the Lymphatic system.

<h3>What is Lymphatic System?</h3>

A network of tissues, veins, and organs known as the lymphatic system collaborates to transport lymph, a colorless, watery fluid, back into your circulatory system (your bloodstream).

Your body's arteries, smaller arteriole blood vessels, and capillaries each day carry about 20 liters of plasma. About 17 liters are then returned to the circulation through veins after providing nourishment to the body's cells and tissues and collecting their waste products. The remaining three liters permeate your body's tissues via capillaries. The lymphatic system gathers this extra fluid, which is now known as lymph, from your body's tissues and transports it to various locations before returning it to your bloodstream.

To learn more about Lymphatic system with the help of the given link:

brainly.com/question/13314899

#SPJ4

3 0
2 years ago
Which kind of organism is an autotroph?
trasher [3.6K]
The answer would be algae or phytoplankton
3 0
3 years ago
Read 2 more answers
Other questions:
  • Amelia is working with two chemical solutions in her chemistry laboratory. Solution A neutralizes an acidic solution and solutio
    10·2 answers
  • Which species is likely to exhibit random dispersion ?
    13·1 answer
  • The system that removes waste in the blood from the body
    8·1 answer
  • What are some characteristics that all animals share?
    7·2 answers
  • A major misconceptionabout natural selection is that this mechanism "gives orginisms what they want or need so they can adapt to
    7·2 answers
  • Which of these biomolecules increase membrane fluidity and help prevent the cell membrane
    11·1 answer
  • If you had a way of looking into the nucleus of a cell and visually inspecting the genetic material you would see the following:
    6·1 answer
  • HELP ME!!!! I’m so confused and this is a test
    14·1 answer
  • The area labeled X is known as
    5·1 answer
  • Which of these pairs of organisms are most closely related?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!