1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Cerrena [4.2K]
3 years ago
9

You work in a laboratory that studies the molecular biology of tribbles. [Although tribbles are an alien life form, assume here

that the molecular biology of tribbles is identical to that of eukaryotes on Earth.]Your lab has a genomic library of tribble DNA, as well as a cDNA library made with mRNA extracted from whole tribbles. The lab also has a collection of live tribbles that can be used to isolate RNA or DNA, and a supply of fixed tribbles that can be stained for gene expression.Your advisor provides you with a cloned 100 bp DNA fragment that represents part of the protein-coding region of a tribble gene. Using the tools described in the previous paragraph and the molecular biology techniques we have discussed in class, how would you accomplish each of the following aims? Note: try to come up with the simplest and modest direct approach that will give you the desired information.A. Determine the amino acid sequence of the complete protein produced by that gene.B. Determine whether or not the gene contains introns.C. Determine whether the RNA produced by that gene experiences alternative splicing.D. Determine the length of the mature mRNA(s) produced by the gene. This includes the UTRs and the poly-A tail.E. Determine which cells in the tribble body do and do not express mRNA from this gene.F. You discover a blood stain in the lab, and you want to determine whether it is human blood or tribble blood. How can you do this using the molecular biology tools described above?
Biology
1 answer:
Helga [31]3 years ago
8 0

Answer:

Explanation:

A) to determine amino acid sequence of the protein produced by that gene. We will use cDNA library, we will hybridize given part of DNA sequence ( as this part only contains exon part). Than we will isolate the hybridize part and translate this sequence using generic coding table.

B) for determine presence or absence of introns in gene used isolated cDNA in first question. Now we will add this cDNA to DNA library. Here cDNA due to complementary mature binds with DNA. If cDNA binds completely with gene with out looping part of gene it shows that gene is having only exons .

And if along with hybridization part some looped part present in between-- it shows both exons and intron are present.

C) for determining alternative splicing we will use cDNA library.

d) to determine length of mature mRNA which includes both the UTR and poly A sequence we will go for cDNA cloning and look for particular cDNA complementary to DNA segments. And later we isolate that cDNA and examine its whole length

E) to determine which cells in the tribble body express this particular mRNA . We use fluorescent tagged small DNA part provided. Then we will add this DNA probe to supplied tribes. The cells which are expressing , will have cDNA will bind to probe and florescent can be detected. Cells which are not expressing that gene, here probe will not bind and no fluorescence.  

F) to determine that whose blood strain is this. We will do VBTR profiling . Which VNTR profiling similar to belief stain help to determine which blood stain is this.

You might be interested in
Select the correct answer.
natali 33 [55]
The best answer would probably be observation because a hypothesis and theory is not always reliable. an observation describes what IS happening during the experiment.
4 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
The nurse is caring for a terminally ill patient. how can the nurse actively communicate with the patient?
Nataly [62]
By asking open-ended questions
6 0
3 years ago
Please help fill this out
Pavlova-9 [17]

Answer:

1.  speed, direction

2. velocity

3. forward, backward

4. y-axis, x-axis

5. increasing

6. decreasing

7. constant

Explanation:

4 0
3 years ago
Read 2 more answers
Select all that apply. Cell structures that plant and animal cells don't share are _____.
olga_2 [115]
A cell wall. Animal cells do not have a cell wall have plants have a cell wall.
5 0
3 years ago
Read 2 more answers
Other questions:
  • A metallic taste in the mouth, explosive diarrhea, and a skin rash are most indicative of:
    13·1 answer
  • If the gametes produced by a given organism contain 6 chromosomes, how many chromosomes are found in that organism's body cells?
    8·1 answer
  • Which cell organelle contains coded directions for production of proteins? Question 3 options: endoplasmic reticulum lysosome Go
    14·1 answer
  • All amino acids have a similar structure. Which component is responsible for the differences in the 20 amino acids
    13·2 answers
  • What base is found in mRNA but not DNA?
    5·2 answers
  • jak nazywa sie proces w którego wyniku powstaja chmury : a) parowanie b) skraplanie c) krzepiecie d) topienie​
    11·1 answer
  • What are some examples of the ecological populations?
    9·1 answer
  • What temperature does solid rock need to reach to melt and form liquid lava?
    11·1 answer
  • How can water return to Earth from the atmosphere?
    12·2 answers
  • The odds of expected outcomes of a physical characteristic in a particular breeding
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!