1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
earnstyle [38]
3 years ago
8

As organisms become more complex and increase in size they develop a need for a

Biology
1 answer:
lys-0071 [83]3 years ago
6 0

Answer:

Recently work in evolution theory has proposed that by relaxing selection pressure, which typically acts to streamline genomes, the complexity of an organism increases by a process called constructive neutral evolution.

Explanation:

You might be interested in
The location of the Krebs cycle enzymes in eukaryotes is in the mitochondria, while in bacteria the enzymes are found in the ___
kherson [118]

Answer:

cytoplasm

Explanation:

Bacteria as a prokaryotic cell and prokaryotic cells do not have true nucleus or membrane bounded organelles. Therefore all biological activities takes place in the cytoplasm of the cell as well as the enzymes needed for the synthesis of fatty acid are found in the cytoplasm.

5 0
3 years ago
Read 2 more answers
A group of students is asked to make a model of a plant cell. The group is given different objects to represent cell parts. Thes
LUCKY_DIMON [66]

Answer:

mini solar cells is the answer.

3 0
3 years ago
A population in which the frequency of alleles remains the same over generations is said to be in genetic equilibrium. Describe
DochEvi [55]

Answer:

Natural selection disrupts the genetic equilibrium by favoring the genes for the traits that impart survival advantage to individuals.

Explanation:

Natural selection refers to the unequal survival rate of individuals of a population due to the presence of some beneficial adaptive genetic trait. These individuals are able to survive more and leave more progeny. Over generations, the population has increased number of these individuals leading to evolution of a population with different allele frequencies.  

For example, the frequency of gene for antibiotic resistance in the bacterial population was increased once humans started using antibiotics to control the bacterial population. This led to the evolution of the bacterial population with antibiotic resistance.  

7 0
3 years ago
What is the purpose of the Line of defense
rusak2 [61]

Answer:

The three lines of defense model enhances the understanding of risk management and control by clarifying roles and duties. The model provides guidance for the implemented structure and the assigned roles and responsibilities of parties to increase the effective management of risk and control

Explanation:

the first line of defence – functions that own and manage risk. the second line of defence – functions that oversee or specialise in risk management, compliance. the third line of defence – functions that provide independent assurance, above all internal audit.

7 0
4 years ago
Read 2 more answers
A)shrink<br>b)swell<br>c)neither ​
BlackZzzverrR [31]

Answer:

b)swell

Explanation:

good luck

7 0
3 years ago
Read 2 more answers
Other questions:
  • Suppose a deposit of gold-containing rock was discovered, and geologists determined that the amount of gold in the rock was too
    9·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Bianca is very self-conscious about her weight. she indulges in strict dieting and often skips her meals. as a result, she was r
    15·1 answer
  • Sequences that contain information about the stability of a transcript are found in the
    10·1 answer
  • Which of the following fluids are typically released through the penis?
    12·2 answers
  • Explain how leaves are adapted to carry out photosynthesis?​
    9·1 answer
  • Can someone help me with this question
    13·2 answers
  • Hi hi hi hi hi hi hi hi hi hi hi hi hi hi<br> peeeeeeeeeeeeople dont know y i ask thut question
    8·2 answers
  • What type of reproduction is needed in order for there to be genetic variation?.
    9·1 answer
  • The graph demonstrates the quantitative variation for skin pigmentation.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!